Specific primer used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences

A flanking sequence and specificity technology, applied in the field of specific primers, can solve the problems of large quantity, time-consuming and laborious, difficult to improve experimental efficiency, etc., and achieve the effect of simple operation

Inactive Publication Date: 2012-08-29
SHANGHAI UNIV
View PDF10 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method requires a large amount of DNA, and doing Southern and reverse PCR is time-c

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences
  • Specific primer used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences
  • Specific primer used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Acquisition and application of Ac terminal specific primers

[0039] According to the annotation in Genebank with the sequence number GU595147, the present invention extracts the sequence of the Ac transposon contained therein and designs primers. Ac-end primers that can be used in combination with adapter primers to amplify sequences flanking the 5' end of Ac / Ds are:

[0040] Primer name sequence Ac22r TTTTCCCATCCTACTTTTCATCC Ac53r CGGTTATACGATAACGGTCGGT Ac86r GTTCGAAATCGATCGGGA Ac169r TCGGGAAACTAGTCTACCG Ac215r ACGAAACGGGATCATCCC Ac281r TCAGTGGTTATGGATGGGAGT Ac317r CAGCGTTCGCTAGGTATTTCTA

[0041] Ac-end primers that can be used in combination with adapter primers to amplify sequences flanking the 3' end of Ac / Ds are:

[0042] Primer name sequence Ac4131f CCAGATGTGAGCAAGTGATTATG Ac4217f TAGCCAAGAGCCCAAGACTTATCAC Ac4411f ACCCGACCGGATCGTATCGG Ac4442f CGTAT...

Embodiment 2

[0062] Example 2: Acquisition of primers and methods for distinguishing Ac or Ds flanking sequences

[0063] In the present invention, the two Ds elements of bz-m2 (DI) and r1::m3 are respectively used as the reporter genes of the two Ac donors of apt1-m1::Ac and su1::Ac. The two Ds elements, bz-m2 (DI) and r1::m3, are both products of Ac internal sequence deletions. The full-length sequence of Ac is 4565bp, the Ds element in bz-m2 (DI) is missing a section of 1310bp from the 1265th bp to 2575 bp of the Ac element, the Ds element in r1::m3 is missing the part from the Ac element A segment of 2521bp from 1051 bp to 3571 bp in total.

[0064] The present invention intercepts the sequence of the Ac transposon contained therein according to the annotation in Genebank whose sequence number is GU595147, and compares the two Ds elements of bz-m2 (DI) and r1::m3 with respect to the complete Ac element In the case of missing sequences, Ac internal specific primers were designed to di...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a primer and method used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences. The primer is shown as follows: a-, an Ac terminal specific primer used for separating Ac/Ds 5' flanking sequences is a base sequence shown by SEQIDNO:1-SEQIDNO:7; b-, an Ac terminal specific primer used for separating Ac/Ds 3' flanking sequences is a base sequence shown by SEQIDNO:8-SEQIDNO:14. The invention relates to a specific primer and method used for identifying and distinguishing the Ac and Ds flanking sequences. The invention is characterized in that the primer is the base sequence shown by SEQIDNO:15-SEQIDNO:18. The Ac specific primers can be well amplified to obtain the Ac or Ds flanking sequences in a genome. The detection method is simple in operation and is an important technical means for obtaining the Ac flanking sequences of Ac mutants on a large scale and separating genes of Ac insertion mutants.

Description

technical field [0001] The present invention relates to specific primers for isolating and identifying Ac / Ds transposon flanking sequences in maize Ac / Ds transposition mutants. Background technique [0002] Corn is the world's largest food crop and the main food source in the world. The total output of corn in my country has surpassed that of wheat, becoming the second largest food crop after rice. And maize has long been a genetic model plant. The sequence of the maize B73 genome has been completed, which will accelerate scientific research in maize. At least 32,000 genes are estimated to exist in maize, and the cloning and functional analysis of these genes has become the next major challenge. Among the methods of gene cloning, insertion mutation research is a very effective method. It mainly includes T-DNA insertion mutation and transposon insertion mutation. Due to the limitations of transgenic technology, it is difficult to apply T-DNA insertion method for insertio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor 王飞李鹏飞徐大彬郭圣明赵志伟樊军宋任涛许政暟
Owner SHANGHAI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap