Unlock instant, AI-driven research and patent intelligence for your innovation.
Molecular marker related to porcine leukocyte count and application of molecular marker
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of molecular markers and white blood cells, applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc.
Active Publication Date: 2012-09-19
HUAZHONG AGRI UNIV
View PDF2 Cites 2 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
But none of them can fundamentally solve the problem of disease prevention. Improving the body's natural disease resistance has become the focus of current research, especially disease-resistant breeding.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0027] Embodiment 1, the screening of SN gene SNPs
[0028] 1.1 Primer design
[0029] According to the mRNA information of the SN gene in the NCBI database (GenBank accession number: DQ176853), a pair of primers were designed on exon 2 and exon 7 to amplify "Tongcheng pig" (Chinese local pig breed bloodline, local breed commercial variety in Tongcheng County, Hubei Province, a well-known public ) and "Landrace pig" (an imported breed with foreign pig blood, introduced from the United States by the National LivestockEngineering Center of Huazhong Agricultural University, a foreign commercial pig breed that has been popularized and applied on a large scale) the mRNA of the SN gene. The designed primer pair The nucleotide sequence is as follows:
[0030] SN CD3 F 5′ CTATGACTACTC AGGCAAGCG 3′,
[0031] SN CD3 R 5' GGTGT CAGGCATCAG GCTC 3'.
[0032] 1.2PCR amplification
[0033] The total volume of the PCR reaction is 10 μl, which contains about 100 ng of cDNA reverse-tra...
Embodiment 2
[0044] The establishment of embodiment 2SN gene PCR-RFLP diagnosis method
[0045] 2.1 Primer sequence
[0046] A pair of primers containing exon 4 for amplifying the genome sequence of porcine SN was designed to detect the polymorphism of the variation site in the population. The primer pair name and nucleotide sequence are as follows:
[0047] SN SNP F 5′CGGCTGCTGTAGCTCTGATTG 3′
[0048] SN SNP R 5′GCCTTGGCCTGGTTTCCTTA 3′
[0049] 2.2PCR amplification conditions
[0050] The total volume of the PCR reaction is 10μl, including about 100ng of porcine genomic DNA, containing 1×PCR buffer (purchased from Treasure Bioengineering Dalian Co., Ltd.), the final concentration of dNTP is 150μmol / L, the final concentration of primers is 0.4μmol / L, and 0.5U Taq DNApolymer Enzymes (purchased from Treasure Bioengineering Dalian Co., Ltd.). The PCR amplification program is: 94°C for 3min, 35×(94°C for 30s, 61°C for 30s, 72°C for 25s), and finally 72°C for 5min. The PCR reaction prod...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention belongs to the technical field of preparation of molecular markers of domestic animals and particularly relates to a molecular marker related to a porcine leukocyte count, and application of the molecular marker to marker-assisted selection of pigs. The molecular marker is a fragment of an SN gene; a nucleotide sequence of mRNA of the molecular marker is shown as a sequence table SEQ ID NO: 1; a mutantallele exists on a 699 bp site of the sequence table, namely a 367G-367A mutant exists on a 367bp site of a sequence shown as figure 4, which results in Hin6I-RFLP polymorphism. The invention further discloses a primer for amplifying the nucleotide sequence of the SN gene and a polymorphism detection method. The invention further discloses application of the prepared molecularmarker to correlation analysis on the porcine leukocyte count; and a new molecular marker is provided for the marker-assisted selection of the pigs.
Description
technical field [0001] The invention belongs to the technical field of livestock molecular marker preparation, and in particular relates to a molecular marker related to the number of white blood cells in pigs and its application. The invention includes the discovery and detection method of the SN gene variation site related to the number of pig white blood cells and its application in pig marker-assisted selection. Background technique [0002] In the past 10 years, modern breeding technology has significantly improved pig production performance (growth, carcass and meat quality traits), but insufficient attention has been paid to the genetic improvement of pig health and disease resistance. Disease control has always been an important link in animal husbandry production. Preventive measures such as improving management levels, improving sanitation, injecting drugs and vaccines have indeed played an important role in preventing the occurrence of diseases. But none of them ...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More 
