Supercharge Your Innovation With Domain-Expert AI Agents!

Chicken E.tenella MA2 gene, vector, recombinant strain, protein, and application thereof

A technology of Eimeria coccidiosis and protein is applied in the field of genetic engineering to achieve the effect of reducing the usage amount and controlling chicken coccidiosis

Active Publication Date: 2012-12-12
INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, to date, there are no other studies on the immunoprotective properties of this protein against Eimeria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chicken E.tenella MA2 gene, vector, recombinant strain, protein, and application thereof
  • Chicken E.tenella MA2 gene, vector, recombinant strain, protein, and application thereof
  • Chicken E.tenella MA2 gene, vector, recombinant strain, protein, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1 EtMA2 Cloning of Gene Sequences

[0038] 1.1 PCR primer design: according to the predicted E. tenellarod neck protein EtMA2 The cDNA sequence of the gene was designed with Premier Primer 5.0 software and synthesized by Shanghai Yingjun Bioengineering Company:

[0039] upstream primer MA2 F: 5' ATGTGGGGGCAAAACCAGCG 3' (SEQ ID NO: 5);

[0040] downstream primer MA2 R: 5' TTACTGCTGGTCGTAATTCGCGTCT 3' (SEQ ID NO: 6).

[0041] 1. 2 Guangdong strain E. tenella Isolation and purification of merozoites (preserved by the Parasite Laboratory of Veterinary Research Institute of Guangdong Academy of Agricultural Sciences): the method refers to "Chicken Coccidiosis" (Suo Xun, edited by Li Guoqing, Beijing: China Agricultural University Press, 1997.) .

[0042] 1.3 E. tenella Extraction of merozoite total RNA: the method refers to TRIZOL LS of Invitrogen Company ? Reagent kit instructions. The concentration of RNA measured by spectrophotometer was 1 μg / ml; electro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Chicken E.tenella MA2 (Et MA2) gene, a vector thereof, a recombinant strain thereof, a protein thereof, and an application thereof. The amino acid sequence of the EtMA2 protein is represented by SEQ ID No.2. Or the protein is a protein obtained after the amino acid sequence represented by SEQ ID No.2 is subjected to substitution, deletion, and / or addition of one or more amino acids, and / or a protein with terminal modification and with a same activity. The invention also discloses an EtMA2-outsidedomain protein with an amino acid sequence represented by SEQ ID No.4. Or the protein is a protein obtained after the amino acid sequence represented by SEQ ID No.4 is subjected to substitution, deletion, and / or addition of one or more amino acids, and / or a protein with terminal modification and with a same activity. The EtMA2 protein and the EtMA2-outsidedomain protein can be used for preparing eimeria-resisting medicines. Through the immunization of the EtMA2-outsidedomain protein, chicken can be effectively controlled from being infected by E.tenella. Therefore, the dosages of anticoccidial drugs in chicken farms can be greatly reduced, and chicken coccidiosis can be effectively controlled.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to Eimeria tenella MA2 protein( EtMA2 protein) extramembrane domain protein ( EtMA2 -Outside domain) and its coding gene, vector containing the gene, recombinant strain and its application; also relates to Eimeria tenella MA2 Protein and its coding gene, vector containing the gene, recombinant strain and application thereof. Background technique [0002] Chicken coccidiosis is a parasitic disease that seriously endangers the intensive chicken industry and is prevalent worldwide. In the absence of preventive measures or prevention failures (such as drug ineffective due to drug resistance), the incidence of chickens can reach 30%. %-100%, the fatality rate can be as high as 80%. The global economic loss caused by coccidiosis exceeds 3.5 billion U.S. dollars every year, and the economic loss of chicken industry caused by coccidiosis in my country is estimated to be as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/455C12N15/30C12N15/63A61K39/012A61P33/02
Inventor 孙铭飞戚南山廖申权吴彩艳吕敏娜温烈娜谢明权
Owner INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More