Triple minRNA for resisting virus infection of aids and construction method thereof

A virus infection and anti-AIDS technology, applied in the field of molecular biology, can solve the problems of HIV-1 sequence differences, virus gene target sequence prone to mutation, and cannot be knocked out, so as to prolong the duration, improve efficiency, and avoid escape phenomena Effect

Inactive Publication Date: 2013-07-03
HENGYANG NORMAL UNIV
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Its disadvantages are: (1) miRNA can only reduce the expression of the target gene and cannot be knocked out; (2) the virus can change from using one coreceptor (such as CCR5) to another coreceptor (such as CCR5) by changing its own characteristics. such as CXCR4) to continue to infect host cells
[0006] The advantage of choosing the viral HIV-1 genome RNA sequence as the target is that it directly targets the viral RNA, so it has a stronger effect of inhibiting HIV-1 infection; but its disadvantage is that the viral gene target sequence is prone to mutation, and different strains of HIV-1 There are differences in the sequence, so it is easy to escape the silencing effect of siRNA or miRNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Triple minRNA for resisting virus infection of aids and construction method thereof
  • Triple minRNA for resisting virus infection of aids and construction method thereof
  • Triple minRNA for resisting virus infection of aids and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] A triple miRNA against HIV infection, which includes three miRNAs that can simultaneously target the genes ccr5, pol, and vif. The first is the miRNA targeting the gene ccr5, and its target sequence is: TGTAAACTGAGCTTGCTCGCT; the second is targeting the gene The miRNA of pol, its target sequence is: ATAGCTTGGTCCAACCTGTTA; the third is the miRNA for gene vif, its target sequence is: ATGAGTGCTATCATAGTGATG. The three miRNAs produced at the same time interfere with gene ccr5, gene pol, and gene vif respectively, making them unable to express corresponding proteins, thereby achieving the purpose of inhibiting HIV infection and replication.

[0030] The specific steps of the triple miRNA construction method for the above-mentioned anti-HIV infection are as follows:

[0031] A. Design and synthesize miRNA oligomeric single-stranded DNA according to ccr5, pol, and vif gene sequences respectively. The miRNA oligomeric single-stranded DNA sequence is shown in Table 1, where the u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a triple minRNA for resisting virus infection of aids and the construction method thereof. The sequences of the triple minRNA are respectively designed according to gene sequences of ccr5, pol and vif and combined to be miRNA oligomeric and single strand DNA, then double-strand DNA is formed through annealing, then double-strand DNA is respectively inserted into the expression vector of pcDNA<TM> 6.2-GW / EmGFPmiR of miRNA to built the mi RNA expression plasmid, and the jamming effect of mi RNA expression plasmid to target gene can be detected through a Qpcr method. A miRNA string with the best gene interference effect to ccr5, vif and pol is inserted into a carrier of pcDNA 6.2 <TM>-GW / EmGFP, so as to obtain a series-wound interference vector of pcDNA6.2<TM>-GW / EmGFP-ccr5-pol-vif, and then the miR-ccr5-pol-vif in the series-wound interference vector is transferred to a lentiviral vector pLenti6.3 / V5-DEST so as to construct pLenti6.3 / V5-DEST miR-ccr5-pol-vif. The recombinant lentiviral vector can product three miRNA at the same time to cause interference effects to gene ccr5, gene pol and gene vif, so as to prevent the gene ccr5, the gene pol and the gene vif from expressing corresponding protein. Therefore, the effect of controlling Hiv infection and replication can be achieved.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a triple miRNA against HIV infection and a construction method thereof. Background technique [0002] AIDS (AIDS) is an infectious disease caused by AIDS virus (HIV) infection. At present, the treatment of AIDS mainly adopts highly active antiretroviral therapy (HARRT), which can effectively reduce HIV infection in the body. Success has been achieved in terms of quantity, prolonging the asymptomatic time after infection and improving the quality of life of patients. But because HIV is prone to mutations, this approach often leads to the emergence of resistant strains. In addition, the high cost and toxic side effects of this method further limit the wide application of this method. [0003] CCR5 is a coreceptor when HIV infects target cells. The pol gene encodes reverse transcriptase, integrase and proteolytic enzyme, which play a very important role in the replication of HIV-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113A61P31/18C12N15/10C12N15/867C12N15/66
Inventor王芳宇何丽芳滕涛杨海
OwnerHENGYANG NORMAL UNIV