Triple minRNA for resisting virus infection of aids and construction method thereof
A virus infection and anti-AIDS technology, applied in the field of molecular biology, can solve the problems of HIV-1 sequence differences, virus gene target sequence prone to mutation, and cannot be knocked out, so as to prolong the duration, improve efficiency, and avoid escape phenomena Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0029] A triple miRNA against HIV infection, which includes three miRNAs that can simultaneously target the genes ccr5, pol, and vif. The first is the miRNA targeting the gene ccr5, and its target sequence is: TGTAAACTGAGCTTGCTCGCT; the second is targeting the gene The miRNA of pol, its target sequence is: ATAGCTTGGTCCAACCTGTTA; the third is the miRNA for gene vif, its target sequence is: ATGAGTGCTATCATAGTGATG. The three miRNAs produced at the same time interfere with gene ccr5, gene pol, and gene vif respectively, making them unable to express corresponding proteins, thereby achieving the purpose of inhibiting HIV infection and replication.
[0030] The specific steps of the triple miRNA construction method for the above-mentioned anti-HIV infection are as follows:
[0031] A. Design and synthesize miRNA oligomeric single-stranded DNA according to ccr5, pol, and vif gene sequences respectively. The miRNA oligomeric single-stranded DNA sequence is shown in Table 1, where the u...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com