EPSP (5-enolpyruvyl shikimate-3-phosphate) synthase multisite mutant from Malus domestica, and coding gene and application of mutant

A technology of EPSP synthase and multi-site mutation, which is applied to EPSP synthase multi-site mutants derived from apples and their coding genes and application fields, can solve disadvantages and other problems, and achieve improved resistance and strong affinity Sexuality, the effect of high glyphosate resistance

Active Publication Date: 2013-07-17
SHANGHAI ACAD OF AGRI SCI
View PDF7 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a big country in the production and export of glyphosate, my country currently does not have a 5-enolpyruvyl-shikimate-3-phosphate synthase gene with independent intellectual property rights that is suitable for transgenic glyphosate-resistant crops. at a disadvantage in international competition

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • EPSP (5-enolpyruvyl shikimate-3-phosphate) synthase multisite mutant from Malus domestica, and coding gene and application of mutant
  • EPSP (5-enolpyruvyl shikimate-3-phosphate) synthase multisite mutant from Malus domestica, and coding gene and application of mutant
  • EPSP (5-enolpyruvyl shikimate-3-phosphate) synthase multisite mutant from Malus domestica, and coding gene and application of mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1 DNA molecular rearrangement (DNA Shuffling) of EPSP synthase gene

[0019] 1.1 Synthesis of glyphosate-resistant herbicide-resistant gene MDEPSPS derived from apple

[0020] The EPSP synthase gene MdEPSPS from apple was synthesized by gene synthesis method (Nucleic Acids Research, 2004, 32, e98). The sequences of 22 pairs of primers were designed as follows:

[0021] 1.MdEPSPS-1:Tm=54,60mer

[0022] ATGCCGGAGATTGTGCTGCAACCCATCCAAGAAATCTCGGGCACCATAAAGTTGCCGGGT

[0023] 2.MdEPSPS-2:Tm=54,60mer

[0024] CAGCAGAATTCGATTCGACAACGACTTGGAACCCGGCAACTTTATGGTGCCCGAGATTTC

[0025] 3.MdEPSPS-3:Tm=54,60mer

[0026] TCCAAGTCGTTGTCGAATCGAATTCTGCTGATTGCTGCCTCTCTCTGAGGGAACAACTGTT

[0027] 4.MdEPSPS-4:Tm=54,60mer

[0028] AATATCTTCACTATTCTAACAAGTTGTCAACAACAGTTGTTCCCTCAGAGAGAGCAGCAAT

[0029] 5.MdEPSPS-5:Tm=54,60mer

[0030] GTTGACAACTTGTTAGATAGTGAAGATATTCATTATATGCTTGGTGCATTGAAAACCCTT

[0031] 6.MdEPSPS-6:Tm=54,60mer

[0032] GTTTTCCTTGTCCTTCTTCAACATCCAGCCCAAGGGTTTTCAAT...

Embodiment 2

[0119] Example 2 High glyphosate resistance EPSP synthase screening

[0120] The above-mentioned recovered and rearranged EPSP synthase gene fragment was digested with BamH I and Sac I, and then constructed into the prokaryotic expression vector pG251 (CN1338515) between the promoter and the t1t2 terminator, which carries the ampicillin resistance gene. Transform Escherichia coli strain DH5α by electroporation to obtain mutant expression library with a capacity of 10 8 , and then use a large number of plasmid extraction kits (Omega, USA) for plasmid extraction.

[0121] Take 1 μl of a large amount of extracted plasmid and transfer it into Escherichia coli ER2799 (NEB Company) and spread it on an M9 plate containing 50mM glyphosate for 48 hours. Three colonies were found to grow well. These three colonies were inoculated on the M9 plate containing 50mM and 80mM glyphosate, and it was found that only one clone could grow on the M9 plate containing 80mM glyphosate. The plasmid ...

Embodiment 3

[0122] The EPSP expression of embodiment 3 high glyphosate resistance

[0123] 3.1 Sequence analysis of DNA fragments highly tolerant to glyphosate

[0124] The highly tolerant glyphosate plasmid pMdEPSPS obtained by screening in Example 2 was utilized step-by-step sequence determination method mutant Full sequence DNA sequencing. The analysis results showed that the highly glyphosate-resistant mutant contained the following 1 to 8 mutation sites on the same molecule, specifically: mutation site 1 (N63D), which is the 63rd position in the amino acid sequence of EPSP synthase Asparagine is replaced by aspartic acid; mutation site 2 (N86S), that is, asparagine at position 86 is replaced by serine; mutation site 3 (T101A), that is, threonine at position 101 Replaced with alanine; mutation site 4 (A187T), that is, alanine at position 187 was replaced with threonine; mutation site 5 (D230G), that is, aspartic acid at position 230 was replaced Glycine; mutation point 6 (H317R), t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an EPSP (5-enolpyruvyl shikimate-3-phosphate) synthase multisite mutant from Malus domestica, and a coding gene and application of the mutant. The mutant has 8 mutation sites, the amino acid sequence of the mutant is as SEQ ID No. 1, and the base sequence of the coding gene of the mutant is as SEQ ID No. 2. Tests show that the EPSP synthase multisite mutant from Malus domestica and the coding gene thereof have high glyphosate resistance, high PEP (phosphoenolpyruvic acid) affinity is kept, and accordingly possibility for using the coding gene for cultivation of transgenic crops is provided.

Description

technical field [0001] The invention belongs to the field of microorganisms, and relates to a multi-site mutant of EPSP synthase derived from apple (Malus domestica) and its coding gene and application, in particular to a method of using DNA molecular rearrangement (DNA shuffling) and functional complementation to The gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSP synthase) derived from apple was modified to obtain multi-site mutants, and then the encoded gene was applied to the research of glyphosate resistance and rice Transformation and genetically modified crops are being cultivated. Background technique [0002] The shikimate pathway is an important pathway for the synthesis of aromatic amino acids in plants and microorganisms. EPSP synthase is a key enzyme in the shikimate pathway, catalyzing 3-phosphoshikimate (S3P) and phosphoenolpyruvate (PEP) to generate 5-enolpyruvyl-shikimate-3-phosphate synthase (5-enolpyruvyl shikimate-3-phosphate synthase, E...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/63A01H5/00
Inventor田永生许晶姚泉洪彭日荷赵伟付晓燕韩红娟高建杰韩静王波王丽娟
OwnerSHANGHAI ACAD OF AGRI SCI