Microbial bacterial strain and application thereof
A technology of microorganisms and strains, applied in the field of microorganisms, can solve the problems of starch residue, miscellaneous gas, burnt smell, etc., and achieve the effects of easy cultivation, reduction effect, and fast fermentation speed.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0018] The applicant obtained a strain from the surface of tobacco leaves that had been naturally aged for more than 3 years after isolation and screening. The microbial strain was LBT XP01, which was classified and named as Bacillus sp. The budding microbial strain LBT XP01 was not only related to schools It was deposited in the General Collection Center of the China Microbial Culture Collection Management Committee (CGMCC) on April 19, 2013. It was found to be alive and was deposited in the General Collection Center of the China Microbial Culture Collection Management Committee The number is CGMCC No.7495, and it will be stored for 30 years from April 19, 2013.
[0019] The 16S rRNA gene sequence of Bacillus sp. is as follows (GenbankAccession number: KF017201):
[0020] GTTGCCGGGCGGCGTGCTATACATGCAAGTCGAGCGGACAGATGGGAGCTTGCTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGATGGACCCGCG...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap