Check patentability & draft patents in minutes with Patsnap Eureka AI!

Microbial bacterial strain and application thereof

A technology of microorganisms and strains, applied in the field of microorganisms, can solve the problems of starch residue, miscellaneous gas, burnt smell, etc., and achieve the effects of easy cultivation, reduction effect, and fast fermentation speed.

Active Publication Date: 2013-09-25
NORTHWEST A & F UNIV +1
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the starch in the harvested tobacco leaves is degraded into reducing sugar through baking and conditioning, but there is still a certain amount of starch residue, about 1% to 6% (Wang Huaizhu et al., 2005). Starch has an adverse effect on the quality of tobacco leaves (Weeks1985), mainly affecting the burning rate and completeness of burning tobacco leaves, and it will produce burnt smell, miscellaneous gas and irritation when smoking, which will adversely affect the aroma (Wang Ruixin, 2003 ; Wang Dongsheng, 2002)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microbial bacterial strain and application thereof
  • Microbial bacterial strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0018] The applicant obtained a strain from the surface of tobacco leaves that had been naturally aged for more than 3 years after isolation and screening. The microbial strain was LBT XP01, which was classified and named as Bacillus sp. The budding microbial strain LBT XP01 was not only related to schools It was deposited in the General Collection Center of the China Microbial Culture Collection Management Committee (CGMCC) on April 19, 2013. It was found to be alive and was deposited in the General Collection Center of the China Microbial Culture Collection Management Committee The number is CGMCC No.7495, and it will be stored for 30 years from April 19, 2013.

[0019] The 16S rRNA gene sequence of Bacillus sp. is as follows (GenbankAccession number: KF017201):

[0020] GTTGCCGGGCGGCGTGCTATACATGCAAGTCGAGCGGACAGATGGGAGCTTGCTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGATGGACCCGCG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microbial bacterial strain, namely the microbial bacterial strain LBT XP01. The microbial bacterial strain LBT XP01 is classified and named as bacillus(Bacillus sp.), preserved in China General Microbiological Culture Collection Center(CGMCC)of China Committee for Culture Collection of Microorganisms(CCCCM) with a preservation number of CGMCC No.7495. The bacterial strain is obtained from separating and screening of the alcoholized tobacco leaf surface, and is a new microbial bacterial strain. The bacterial strain is used for fermentation technology of tobacco leaves and other a plurality of types of tobacco products and can reduce starch and proteins in the tobacco leaves. After the treatment of the microbial bacterial strain, the starch and proteins in the tobacco leaves can be reduced by 33% and 20% respectively, so that the degradation effect is obvious.

Description

Technical field [0001] The invention belongs to the field of microbial technology, and specifically relates to a microbial strain and its application for simultaneously degrading starch and protein in tobacco leaves. Background technique [0002] There are many types of tobacco, such as oriental tobacco, flue-cured tobacco, and burley tobacco. Their chemical components are similar, but there are also differences, so that they can be appropriately selected according to the needs of the cigarette industry to form leaf groups, and go through the process of flavoring, adding materials, and rolling. Become a cigarette product with certain sensory characteristics. Among the various chemical components of tobacco, starch and protein are two important macromolecular compounds that exist in various types of tobacco. [0003] The physiological and biochemical changes of starch in tobacco leaves determine the degree of coordination among various chemical components in the leaves after curing...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A24B15/20C12R1/07
Inventor 吕欣赵德学马玲玲胡喜怀郭志刚张晓妮
Owner NORTHWEST A & F UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More