Nucleic acid aptamer specifically binding to human epidermal growth factor acceptor III type mutant and applications thereof
A technology of epidermal growth factor and nucleic acid aptamer, which is applied in the field of biomedicine, can solve the problems of drug resistance and side effects, and achieve the effect of broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Experiment 1. Preparation of nucleic acid aptamers that specifically bind to a glioma cell line (U87Δ) overexpressing human epidermal growth factor receptor type III mutant (EGFRvIII)
[0062] 1. Design and synthesize initial ssDNA library and primers for PCR amplification
[0063]Design and synthesize an initial ssDNA library with a length of 73 bases: 5'-GCAATGGTACGGTACTTCC(30N)CAAAAGTGCACGCTACTTTGCTAA-3'. The two ends of the initial ssDNA library are fixed sequences, and the middle is 30 random sequences. N represents A, T, C, G four random bases.
[0064] The upstream primer F1: 5'-GCAATGGTACGGTACTTCC-3' and the downstream primer R1: 5'-TTAGCAAAGTAGCGTGCACTTTTG-3' for amplifying dsDNA were designed and synthesized.
[0065] Design and synthesize upstream primer F1: 5’-GCAATGGTACGGTACTTCC-3’ and downstream primer R2: 5’- GCTAAGCGGGTGGGACTTCCTAGTCCCACCCGCGC TTAGCAAAGTAGCGTGCACTTTTTG-3'.
[0066] The above-mentioned initial ssDNA library and primers were synthesize...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 