Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid aptamer specifically binding to human epidermal growth factor acceptor III type mutant and applications thereof

A technology of epidermal growth factor and nucleic acid aptamer, which is applied in the field of biomedicine, can solve the problems of drug resistance and side effects, and achieve the effect of broad application prospects

Active Publication Date: 2015-07-01
SOUTHERN MEDICAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although EGFR has been used as a biological target at present, a large number of EGFR inhibitors have been developed for the treatment of tumors. However, in view of the expression of EGFR in normal cells, it has a large side effect, and drug resistance appears when the medication time increases. New specific targets are imminent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer specifically binding to human epidermal growth factor acceptor III type mutant and applications thereof
  • Nucleic acid aptamer specifically binding to human epidermal growth factor acceptor III type mutant and applications thereof
  • Nucleic acid aptamer specifically binding to human epidermal growth factor acceptor III type mutant and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Experiment 1. Preparation of nucleic acid aptamers that specifically bind to a glioma cell line (U87Δ) overexpressing human epidermal growth factor receptor type III mutant (EGFRvIII)

[0062] 1. Design and synthesize initial ssDNA library and primers for PCR amplification

[0063]Design and synthesize an initial ssDNA library with a length of 73 bases: 5'-GCAATGGTACGGTACTTCC(30N)CAAAAGTGCACGCTACTTTGCTAA-3'. The two ends of the initial ssDNA library are fixed sequences, and the middle is 30 random sequences. N represents A, T, C, G four random bases.

[0064] The upstream primer F1: 5'-GCAATGGTACGGTACTTCC-3' and the downstream primer R1: 5'-TTAGCAAAGTAGCGTGCACTTTTG-3' for amplifying dsDNA were designed and synthesized.

[0065] Design and synthesize upstream primer F1: 5’-GCAATGGTACGGTACTTCC-3’ and downstream primer R2: 5’- GCTAAGCGGGTGGGACTTCCTAGTCCCACCCGCGC TTAGCAAAGTAGCGTGCACTTTTTG-3'.

[0066] The above-mentioned initial ssDNA library and primers were synthesize...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid aptamer specifically binding to human epidermal growth factor acceptor III type mutant and applications thereof. The nucleotide sequence of the nucleic acid aptamer is shown as any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5. The nucleic acid aptamer is bound with only a U87[delta] cell line, and not bound with a U87 cell line or a HEK293 cell line, and therefore the nucleic acid aptamer can be effectively applied for preparing sensors or kits that diagnose tumor cells expressing EGFRvIII. In addition, the nucleic acid aptamer can be used as a carrier carrying an anti-EGFRvIII-expressed-tumor-cell medicine or siRNA to enter into the tumor cells expressing the EGFRvIII or tumor tissues expressing the EGFRvIII, and therefore the nucleic acid aptamer has a targeting function and a wide application prospect.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a nucleic acid aptamer specifically combined with a human epidermal growth factor receptor type III mutant and an application thereof. Background technique [0002] In recent years, some biomarkers for cancer diagnosis and treatment have been studied. Of these, cancer cell-specific membrane proteins are considered the most appropriate biomarkers, as they are often shed in detectable amounts in body fluids, and the clinical presentation of body fluids is often superior to invasive methods of biopsy sampling. In addition to this, membrane proteins have attracted much attention due to their potential use in cancer tissue imaging and targeted therapeutic strategies. [0003] Meanwhile, the field of biomarker identification mainly relies on two-dimensional electrophoresis (2D-GE) and mass spectrometry. However, there are considerable limitations to elucidating membrane protein...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115C12Q1/68A61K47/26A61K48/00A61P35/00
Inventor 张兴梅谭燕伍锡栋梁惠玉高天明
Owner SOUTHERN MEDICAL UNIVERSITY