Check patentability & draft patents in minutes with Patsnap Eureka AI!

Down-regulation of a homeodomain-leucine zipper i-class homeobox gene for improved plant performance

A leucine zipper, plant technology, applied in the field of molecular biology, can solve problems such as yield loss

Inactive Publication Date: 2014-01-08
PIONEER HI BRED INT INC
View PDF97 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Delayed or slow remobilization can lead to yield loss

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Down-regulation of a homeodomain-leucine zipper i-class homeobox gene for improved plant performance
  • Down-regulation of a homeodomain-leucine zipper i-class homeobox gene for improved plant performance
  • Down-regulation of a homeodomain-leucine zipper i-class homeobox gene for improved plant performance

Examples

Experimental program
Comparison scheme
Effect test

example

[0235] The following examples are offered to illustrate rather than limit the claimed subject matter. Various modifications by those skilled in the art are intended to be included within the spirit and scope of this application and the purview of the appended claims.

example 1

[0236] Example 1: Isolation of sequences from maize

[0237] To generate the sense strand of the hairpin, primers were designed as the ZmME293 primer with BamHI on the 5' end and PstI on the 3' end:

[0238] Clone 451, 5'-3' ZmME293 fragment, BamHI and PstI cleavage sites on the primer (563bp) (SEQ ID NO: 34)

[0239] Primers:

[0240] Forward (with BamHI site) (SEQ ID NO: 35)

[0241] GAGCGCAGGCGAAGGATCCAACAATACGAC

[0242] Reverse (with PstI site) (SEQ ID NO: 36)

[0243] CTCCCGCTGCAGACGGCACGGGCCATGACG

[0244] To generate the antisense strand of the hairpin, the primers were designed as ZmME293 primers with SfuI at the 5' end and AgeI at the 3' end:

[0245] Clone 515, 5'-3'ZmME293 fragment, SfuI and AgeI cleavage sites are on the primer (572bp) SEQ ID NO: 37)

[0246] Primers:

[0247] Forward (with SfuI site) (SEQ ID NO: 38)

[0248] TTCGAACGCAGGCGAAGGATGGAACAATACGAC

[0249] Reverse (with AgeI site) (SEQ ID NO: 39)

[0250] ACCG...

example 2

[0280] Example 2: Down-regulation of ZmME293 by expression of fermented RNA

[0281] As noted previously, plant cells and plants can be modified by introducing ZmME293 polynucleotide sequences programmed to effect RNA silencing or interference. This example describes hairpin RNA expression cassettes for modifying, for example, drought tolerance, NUE, seed or biomass yield, density tolerance, or other phenotypes in maize. As noted previously, downregulation of ZmME293, eg, by expression of hairpin RNA (hpRNA), can result in plants or plant cells having reduced expression (up to and including undetectable expression) of one or more ZmME293s.

[0282] One or more ZmME293 genes (such as ZmME293 promoter, other untranslated regions or coding regions) have specific expression of hpRNA molecules in plants, such as drought tolerance and density tolerance of plants can be changed by RNA interference , seed or biomass yield and / or nitrogen use efficiency phenotypes.

[0283]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Methods for modulating plants using optimized ZmME293 down-regulation constructs are disclosed. Also disclosed are nucleotide sequences, constructs, vectors, and modified plant cells, as well as transgenic plants displaying increased seed and / or biomass yield, improved tolerance to abiotic stress such as drought or high plant density, improved nitrogen utilization efficiency, increased ear number and / or reduction in time to scenescence.

Description

technical field [0001] The present invention generally relates to the field of molecular biology and relates to the regulation of the expression or activity of genes and proteins affecting yield, abiotic stress tolerance and nitrogen use efficiency in plants. Background technique [0002] Cereal crops need to complete the process of transferring nutrients from leaves to grain by the end of the season in order to realize their grain yield potential. Delayed or slow remobilization can lead to yield loss. Additionally, grain moisture needs to reach low enough levels for harvesting. Accelerating the whole process of retransfer (leaf senescence) and grain dry down is not only an important agronomic trait for high yield but also crucial for shortening the maturity period of crops. [0003] A maize gene with similarity to the homeodomain-leucine zipper class I homeobox gene has been cloned and transgenic constructs generated to downregulate its endogenous expression in maize. Tr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/82
CPCC12N15/8282C12N15/8261C07K14/415Y02A40/146C12N15/113
Inventor 郭梅牛小牧M.卢普J.舒斯勒
Owner PIONEER HI BRED INT INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More