Single-guide RNA (sgRNA) fragment and application thereof

A fragment and DNA sequence technology, applied in sgRNA fragments and its application fields, can solve the problems of heavy workload and achieve the effects of low cost, high targeting efficiency and short construction time

Active Publication Date: 2014-05-28
CYAGEN BIOSCI INC
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But it is also based on protein recognition base sequence, the workload is relatively large

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single-guide RNA (sgRNA) fragment and application thereof
  • Single-guide RNA (sgRNA) fragment and application thereof
  • Single-guide RNA (sgRNA) fragment and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Target gene: mouse Myod1 gene. See SEQ ID NO: 344 for the full length of the Myod1 gene. Ensembl gene number: ENSMUSG00000009471. Myod1 gene contains 3 exons, including exon1, exon2 with ATG start codon and exon3 with TAG termination.

[0029] Find the target site in exon1, construct the sgRNA (exon1: sgRNA1) expression vector, and use sgRNA1 to guide Cas9 to produce a break at the target site. sgRNA1: TGCTCATCCTCACGAGC^GCCTGG (-strand), where TGG of sgRNA1 is the PAM recognition site.

[0030] Select a partial sequence on the full length of the Myod1 gene as the binding target sequence and name it Myod1A. The sequence of Myod1A is:

[0031] Myod1A5'TGCACCCAGGCCCAGGCGCTCGTGAGGATGAGCATGTGCGCGCGC-3'Myod1A3'ACGTGGGTCCGGGTCCGCGAGCACTCCTACTCGTACACGCGCGCG-5'sgRNA1: TGCTCATCCTCACGAGCGCC;

[0032]The partial sequence TGCTCATCCTCACGAGCGCC in sgRNA1 can just complement and pair with GGCGCTCGTGAGGATGAGCA in the above sequence to recognize the target sequence.

Embodiment 2

[0033] Construction of the expression vector of embodiment 2 sgRNA fragment

[0034] 1. Linearized sgRNA1 cloning vector pCR-Blunt II-TOPO:

[0035] sgRNA1 cloning vector: a circular plasmid that sequentially includes the mouse U6 promoter, the DNA recognition sequence of the sgRNA fragment, the fixed sequence of the DNA sequence of the sgRNA fragment, and the TTTTTT termination sequence. The linearized sgRNA cloning vector was obtained by digestion with AflII enzyme.

[0036] 2. Primer design: (where GNNNNNNNNNNNNNNNNNNN is the DNA sequence of the sgRNA fragment. Due to the use of the U6 promoter, a base G is often added in front of the 20bp sgRNA recognition sequence, or the first base at the 5' end of the sgRNA is replaced by G)

[0037] Primer-F: TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNN

[0038] Primer-R: CNNNNNNNNNNNNNNNNNNNNNCAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAATAGTTGAACTTTTTCACCGTGGCTCAGCCACGAAAAAAA

[0039] PCR amplification, PCR reaction...

Embodiment 3

[0074] Application of embodiment 3 kit

[0075] 1. The kit contains all Myod1 targeting sgRNA plasmids, and transforming them with Cas9 plasmids into mouse ES cells is as follows: combine sgRNA expression plasmids (4Kb, 2ng / μL) with Cas9 expression plasmids (9.6Kb, 4.8ng / μL) equimolar concentration can be mixed and injected into the cells.

[0076] 2. In this example, 66 B6 fertilized eggs were injected, and 53 fertilized eggs survived (survival rate: 0.81), transplanted into 2 surrogate mother mice, and 5 embryos with a gestational age of 12.5 days were obtained.

[0077] 3. PCR amplification was performed on 14 samples with primers Rosa-F / Rosa-R, and the PCR products were sent to Shanghai Sangong and Invitrogen for sequencing. The efficiency of mouse myod1 gene knockout reached more than 80%.

[0078] Rosa-F: TCACCGTCTTTTCAATTCTG

[0079] Rosa-R: TGGCGTTGCGCAGGATCTCCACC

[0080] The result is as follows:

[0081]

[0082] The mutation site mainly occurred 6bp (CCTGG) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sgRNA fragment. The DNA sequence of the sgRNA fragment comprises a length of a fixed sequence and a length of a DNA recognition sequence. The sgRNA can recognize different target sites on double strands of a target gene, bond with nuclease and guide nuclease to bond with the target sites of the target gene through recognition of PAM sequences at the target sites and to start random shearing; then nuclease falls off from a shearing opening, thereby forming a DSB gap; then cells repair the double strands of the target gene through a non-homologous end joining repair mechanism, which leads to frameshift mutation; and finally, the target gene is knocked out. The invention further discloses a gene fixed-point reconstruction method and a gene targeting kit. The invention elaborates a series of sgRNAs applicable to the mouse Myod1 gene, and the sgRNAs have high targeting efficiency, short construction time and low cost and can be highly efficiently used for mouse Myod1 gene targeting.

Description

technical field [0001] The invention belongs to the technical field of gene modification, and in particular relates to a sgRNA fragment and an application thereof. Background technique [0002] At present, the products on the market that can also achieve myod1 gene editing and modification include ZFN target recognition modules and TALE target recognition modules, which rely on ZFN target recognition modules and TALE target recognition modules to specifically recognize a DNA sequence, and use Foki nuclease Cutting the double-stranded DNA, resulting in DNA breaks, can initiate the repair of DNA by cells, so as to realize the genetic manipulation of specific sites such as gene knockout, gene knock-in, gene mutation and gene repair. [0003] ZFNs (zinc-finger nucleases, ZFNs) were considered to be the most potential gene modification technology, which realized the targeted operation of genes and has been widely used. The DNA recognition domain of ZFNs is composed of a series o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/11C12N15/63
Inventor郑敦武黎妃凤刘津欧阳应斌俞晓峰
OwnerCYAGEN BIOSCI INC