Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

PCR (Polymerase Chain Reaction) detection primer and qualitative detection method and kit for specificity of transgenic rice PA110-15 strain

A qualitative detection and specificity technology, applied in the fields of biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems such as PCR detection methods that have not yet been found, and achieve the effect of strong specificity

Active Publication Date: 2014-06-04
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, no method for specific PCR detection of the transgenic rice PA110-15 with the high lysine storage protein gene has been found

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR (Polymerase Chain Reaction) detection primer and qualitative detection method and kit for specificity of transgenic rice PA110-15 strain
  • PCR (Polymerase Chain Reaction) detection primer and qualitative detection method and kit for specificity of transgenic rice PA110-15 strain
  • PCR (Polymerase Chain Reaction) detection primer and qualitative detection method and kit for specificity of transgenic rice PA110-15 strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Acquisition of the Flanking Sequence of the Transgenic Rice PA110-15 Exogenously Inserted Gene

[0034] The target gene for exogenous insertion of transgenic rice PA110-15 with high lysine storage protein gene is LRP gene, and its base sequence is shown in SEQ ID No.1.

[0035] Obtain the integration structure (exogenous insertion gene flanking sequence) by Hi-TAIL PCR

[0036] Step 1: Design upstream and downstream nested primers on the target gene LRP

[0037] LRP-Sp-1TGGTCCTGGAACCATCAAGAAGATC

[0038] LRP-Sp-2ACGATGGACTCCAGTCCGGCCTGCTGGACCTTCTGGAGGCTCTGTT

[0039] LRP-Sp-3CCAAGGGTGATGCTCTCTTCAAGGC

[0040] LRP-Ap1CAGCCTTGAAGAGAGCATCACCCTT

[0041] LRP-Ap2ACGATGGACTCCAGTCCGGCCTGAGTTTCCCAACAGAGCCTCCAGAAGLRP-Ap3GCAAAGCAGCACCACCAACTATGCT

[0042] figure 1 These are the amplification products of the second and third rounds of upstream and downstream Hi-TAIL PCR of the target gene. For analysis of sequencing results, see figure 2 .

[0043] Step 2: Use ...

experiment example 1

[0055] Experimental example 1 Screening of specific primers for qualitative detection of transgenic rice PA110-15 with high lysine storage protein gene and optimization of amplification conditions

[0056] 1. Establishment of transformant-specific detection method

[0057] Nine pairs of transformant-specific primers were designed according to the 3' flanking sequences. The sequence of the junction region between the exogenous insertion vector and the rice genome is amplified, and the size of the amplified product is not less than 100bp.

[0058] A total of 9 pairs of primers were set up, and the primer sequences were as follows:

[0059] Primer 1: The target fragment length is 276bp

[0060] F: TTCGCTCATGTGTTGAGCATAT (SEQ ID No. 3)

[0061] R: GAGATTTGATTTGGCTGATCTAGG (SEQ ID No. 4)

[0062] Primer 2: The target fragment length is 314bp

[0063] F: TTCGCTCATGTGTTGAGCATAT (SEQ ID No. 5)

[0064] R: GTTAAATGTCAACAGCCATCTGC (SEQ ID No. 6)

[0065] Primer 3: The target frag...

experiment example 2

[0090] Experimental example 2 Establishment of specific detection system and reaction program for transgenic rice PA110-15 with high lysine storage protein gene

[0091] 1. Extraction and detection of plant genomic DNA

[0092] 1 Plant DNA Extraction

[0093] 1.1 Preparation of CTAB extraction buffer

[0094] Add 81.7g NaCl and 20g CTAB to 600mL water, after fully dissolved, add 100mL of 1mol / L Tris-HCl (pH7.5) solution, 100mL of 0.5mol / L EDTA (pH8.0) solution, and finally adjust the pH to 8.0 with HCl or NaOH solution , add water to make up to 1000mL. Use after being sterilized under high temperature and high pressure (103.4kPa / 121°C) conditions for 20 minutes.

[0095] 1.2 Extraction method

[0096] a. 100mg sample, fully ground into powder and transferred to a 2ml centrifuge tube;

[0097] b. 1ml of CTAB extraction buffer preheated to 65°C, mix thoroughly, suspend the sample, and mix gently.

[0098] c. Water bath at 65°C for 40 minutes, and mix by inverting several t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PCR (Polymerase Chain Reaction) qualitative detection primer and a qualitative detection method and a kit for specificity of a transgenic rice PA110-15 strain. The invention firstly provides a connection area sequence inserted with a carrier gene and flanking rice sequence in a high-lysine storage protein transgenic rice PA110-15 strain, and the base sequence is shown as SEQ ID No.2. The invention further provides the PCR primer and the qualitative detection method for the specificity of the high-lysine storage protein transgenic rice PA110-15 strain. The specificity verification experiment shows that the PCR qualitative detection method for the specificity of the high-lysine storage protein transgenic rice PA110-15 strain is high in specificity.

Description

technical field [0001] The present invention relates to specific PCR detection primers and detection kits for transgenic rice strains, in particular to specific PCR qualitative detection primers, qualitative detection methods and detection kits for transgenic high lysine storage protein rice PA110-15 strains, belonging to transgenic rice Strain detection field. Background technique [0002] With the widespread planting of genetically modified plants, the safety of genetically modified foods has also attracted great attention. More than 30 countries have successively implemented genetically modified product labeling systems, including China. The implementation of the genetically modified labeling system relies on the component testing of genetically modified plants and their processed products. PCR technology is currently the most widely used method in the detection of genetically modified products at home and abroad. When applying this technique for qualitative detection o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 张秀杰梁利霞宛煜嵩涂巨民金芜军苗朝华李亮高进
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com