Unlock instant, AI-driven research and patent intelligence for your innovation.

Humanized antibody expression vector and construction method thereof

A technology of humanized antibody and expression vector, which is applied in the direction of using vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve laborious and time-consuming problems, and achieve high cutting efficiency and good expression balance

Active Publication Date: 2016-06-15
SHENZHEN ZHONGKE AMSHENN MEDICINE CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the construction of chimeric antibodies and complete humanized antibodies generally needs to amplify the light and heavy chain constant region genes of human antibodies, and then connect with the variable region of the antibody to be expressed by overlapping PCR. In expression vectors, this process is time-consuming and labor-intensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Humanized antibody expression vector and construction method thereof
  • Humanized antibody expression vector and construction method thereof
  • Humanized antibody expression vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 Construction of Humanized Antibody Expression Vector

[0051] Include the following steps:

[0052] 1. Amplify the constant region gene CL-2A of light chain lambda containing 2A

[0053] (1) According to the constant region gene sequence of light chain λ, primers are designed, and the primer sequences are as follows:

[0054] C L Upstream primers: AAGCTT CAGCCCAAGGCTGCCCCCT (SEQ ID NO: 1), containing HindIII restriction site (italic base)

[0055] C L Downstream Primer 1:

[0056]CCAACTTGAGCAGGTCAAAGTTCAAAAGCTGCTATGAACATTCTGTAGG (SEQ ID NO: 2)

[0057] C L Downstream primer 2:

[0058] GGATCC GGGCCCAGGATTGGACTCAACGTCCCCCGCCAACTTGAGCAGGTCAA (SEQ ID NO: 3), containing a BamHI restriction site (italicized bases);

[0059] C L The downstream primers 1 and 2 contain the sequence of 2A. Since the sequence of 2A is relatively long, two PCR reactions are used to add the gene sequence of 2A to the end of the CL chain.

[0060] (2) According to the instru...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a humanized antibody expression vector and a construction method thereof. The construction method comprises the steps of: respectively connecting a 2A sequence-containing light chain constant region gene sequence CL-2A and a heavy chain constant region gene sequence CH with a pMD18-T vector to obtain a pMD18-T-CL-2A plasmid and a pMD18-T-CH plasmid; connecting the pMD18-T-CL-2A plasmid and a eukaryotic expression vector after being subjected to double digestion to obtain a CL-2A-containing eukaryotic expression vector; and then connecting the CL-2A-containing eukaryotic expression vector with a pMD18-T-CH plasmid to obtain a CL-2A-CH-containing eukaryotic expression vector. The construction method of the expression vector disclosed by the invention can be used for rapidly constructing a full-length complete antibody sequence only by inserting a variable region sequence of a mouse or a humanized antibody into a corresponding locus and rapidly constructing a chimeric antibody, the humanized antibody and the like, and is simple and practical.

Description

technical field [0001] The invention belongs to the field of vector construction, in particular, the invention relates to a humanized antibody expression vector and a construction method thereof. Background technique [0002] Due to the high specificity of monoclonal antibodies, it has been widely used in the fields of cell biology, basic medicine, clinical diagnosis, and treatment. But at the same time, monoclonal antibodies also have some defects. Mouse-derived antibodies will produce anti-mouse antibody reaction (HAMA) when applied to human body, which will hinder its clinical application. In order to overcome the shortcomings of monoclonal antibodies, chimeric antibodies, humanized antibodies, etc. are prepared by genetic engineering technology, and the mouse-derived components in the antibodies are reduced on the premise of retaining the specificity of the original antibodies as much as possible. [0003] At present, the construction of chimeric antibodies and complete...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/66C12N15/70
Inventor 万晓春吕卫东
Owner SHENZHEN ZHONGKE AMSHENN MEDICINE CO LTD