Humanized antibody expression vector and construction method thereof
A technology of humanized antibody and expression vector, which is applied in the direction of using vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve laborious and time-consuming problems, and achieve high cutting efficiency and good expression balance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1 Construction of Humanized Antibody Expression Vector
[0051] Include the following steps:
[0052] 1. Amplify the constant region gene CL-2A of light chain lambda containing 2A
[0053] (1) According to the constant region gene sequence of light chain λ, primers are designed, and the primer sequences are as follows:
[0054] C L Upstream primers: AAGCTT CAGCCCAAGGCTGCCCCCT (SEQ ID NO: 1), containing HindIII restriction site (italic base)
[0055] C L Downstream Primer 1:
[0056]CCAACTTGAGCAGGTCAAAGTTCAAAAGCTGCTATGAACATTCTGTAGG (SEQ ID NO: 2)
[0057] C L Downstream primer 2:
[0058] GGATCC GGGCCCAGGATTGGACTCAACGTCCCCCGCCAACTTGAGCAGGTCAA (SEQ ID NO: 3), containing a BamHI restriction site (italicized bases);
[0059] C L The downstream primers 1 and 2 contain the sequence of 2A. Since the sequence of 2A is relatively long, two PCR reactions are used to add the gene sequence of 2A to the end of the CL chain.
[0060] (2) According to the instru...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com