Interfering RNA and lentivirus targeted to OLFM4 gene, and application thereof

A lentivirus and lentiviral vector technology, applied in the field of genetic engineering, can solve the problem of not controlling malignant invasion and metastasis, and achieve the effects of inhibiting in vitro migration and invasion ability, inhibiting OLFM4 gene expression, and inhibiting liver metastasis.

Inactive Publication Date: 2014-08-13
CHILDRENS HOSPITAL OF CHONGQING MEDICAL UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, it has been found that a variety of malignant tumors highly express proteins such as Cyclin D1, which ca...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Interfering RNA and lentivirus targeted to OLFM4 gene, and application thereof
  • Interfering RNA and lentivirus targeted to OLFM4 gene, and application thereof
  • Interfering RNA and lentivirus targeted to OLFM4 gene, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] Example 1 Construction of Lentiviral Vector and Establishment of Stable Infection Cell Line

[0075] 1 material

[0076] 1.1 Cell lines

[0077] Human gastric cancer cell line MKN-45 was purchased from the Shanghai Cell Institute of the Chinese Academy of Life Sciences.

[0078] 1.2 RNA sequence construction of lentivirus

[0079] OLFM4-RNAi interference target sequence: AACGCTTGGAATTCACAGCTC

[0080] NC-RNA-seq: TTCTCCGAACGTGTCACGT

[0081] 1.3 Primer design

[0082] OLFM4 amplification primer sequences:

[0083] OLFM4-F: 5′-ACAGAGTGGAACGCTTGGAA-3′

[0084] OLFM4-R: 5′-CCTTCTCCATGATGTCAATTCG-3′

[0085] Internal reference β-actin amplification primer sequence:

[0086] β-actin-F: 5′-CCAACCGCGAGAAGATGA-3′

[0087] β-actin-R: 5′-CCAGAGGCGTACAGGGATAG-3′

[0088] 1.4 Main reagents and consumables

[0089]

[0090] 1.5 Main Instruments

[0091]

[0092]

[0093] 2 methods

[0094] 2.1 Cell culture

[0095] All gastric cancer cell lines were cultured w...

Embodiment 2

[0258] Example 2 Establishment and Identification of Animal Model of Gastric Cancer Liver Metastasis

[0259] 1 material

[0260] 1.1 Cell lines:

[0261] MKN-45-NC-GFP MKN-45-Si-OLFM4

[0262] 1.2 Animals: Balb / c (nu / nu) nude mice, 6-8 weeks old, weighing 18-20g, SPF level, purchased from Animal Center of Chongqing Medical University

[0263] 1.3 Main reagents and consumables

[0264] Matrigel Weiglass Biotechnology (Beijing) Co., Ltd.

[0265] Transwell culture chamber American BD company

[0266] 4% Paraformaldehyde Beijing Suo Lai Bao Company

[0267] 2 methods

[0268] 2.1 Transwell assay to measure cell migration and invasion ability in vitro

[0269] 2.1.1 Determination of migration ability by Transwell chamber method

[0270] (1) Divide cells into 2×10 5 Spread on a 24-well plate per well and culture in 10% FBS-1640 medium at 37°C for 6-8h until the cells adhere to the wall. (morning of the day)

[0271] (2) After 6-8 hours, the 10% FBS-1640 medi...

Embodiment 3

[0325] Example 3 Preliminary study on the mechanism of action of OLFM4 on gastric cancer cells

[0326] 1 material

[0327] 1.1 Cell lines

[0328] MKN-45-NC-GFP MKN-45-Si-OLFM4

[0329] 1.2 Probe design

[0330] The sequence used to synthesize the NF-κB probe is: 5'-AGTTGAGGGGACTTTCCCAGGC-3'.

[0331] 1.3 Main reagents and consumables

[0332] Cytoplasmic and nuclear protein extraction kit American Pierce Corporation NF-κB p65 mouse anti-human monoclonal primary antibody Santa Cruz Corporation NF-κB p-p65(Ser536) rabbit anti-human polyclonal primary antibody Santa Cruz Corporation NF-κB p50 rabbit / goat anti-human polyclonal primary antibody Santa Cruz Corporation IκB-α rabbit anti-human polyclonal primary antibody Santa Cruz Corporation p-IκB-α mouse anti-human monoclonal primary antibody Santa Cruz Corporation GC-1 rabbit anti-human polyclonal primary antibody Santa Cruz Corporation SP1 rabbit anti-h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides interfering RNA and a lentivirus vector targeted to the OLFM4 gene and application of the interfering RNA and the lentivirus vector in preparation of drugs used for preventing and treating metastasis of stomach cancer tumors to the abdominal cavity or/and the liver. According to the invention, since the interfering RNA can inhibit in vitro migration and invasion ability of gastric cancer cells and liver metastasis capability of gastric cancer cells, decreased expression of OLFM4 is a potential effective mode for treatment of malignant progression of late gastric cancer. It is further determined that an NF-kB signal is an upstream regulation transcription factor of expression of OLFM4 and the interfering RNA has NF-kB signal feeding back and regulating functions.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and mainly relates to the application of silencing OLFM4 gene by using RNAi in the preparation of medicines for preventing and treating stomach cancer metastasis to the abdominal cavity or / and liver. Background technique [0002] Gastric cancer is the second most common malignant tumor in my country and the second leading cause of cancer death. Although the current comprehensive treatment measures for gastric cancer have been continuously developed and improved, the current treatment still cannot achieve satisfactory results. Since most gastric cancer patients are in the middle and late stages when they are first diagnosed, advanced gastric cancer accounts for more than 90% of hospitalized cases, and the 5-year survival rate after surgery is long-term. Hovering around 30-50%. Current studies have found that the main reason for the poor treatment effect of most malignant tumors is metastasis an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/113C12N7/01C12N15/63C12Q1/70C12Q1/68A61K35/76A61P35/00
Inventor 黄轶宋利华李阳包黎明
Owner CHILDRENS HOSPITAL OF CHONGQING MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap