Interfering RNA and lentivirus targeted to OLFM4 gene, and application thereof
A lentivirus and lentiviral vector technology, applied in the field of genetic engineering, can solve the problem of not controlling malignant invasion and metastasis, and achieve the effects of inhibiting in vitro migration and invasion ability, inhibiting OLFM4 gene expression, and inhibiting liver metastasis.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0074] Example 1 Construction of Lentiviral Vector and Establishment of Stable Infection Cell Line
[0075] 1 material
[0076] 1.1 Cell lines
[0077] Human gastric cancer cell line MKN-45 was purchased from the Shanghai Cell Institute of the Chinese Academy of Life Sciences.
[0078] 1.2 RNA sequence construction of lentivirus
[0079] OLFM4-RNAi interference target sequence: AACGCTTGGAATTCACAGCTC
[0080] NC-RNA-seq: TTCTCCGAACGTGTCACGT
[0081] 1.3 Primer design
[0082] OLFM4 amplification primer sequences:
[0083] OLFM4-F: 5′-ACAGAGTGGAACGCTTGGAA-3′
[0084] OLFM4-R: 5′-CCTTCTCCATGATGTCAATTCG-3′
[0085] Internal reference β-actin amplification primer sequence:
[0086] β-actin-F: 5′-CCAACCGCGAGAAGATGA-3′
[0087] β-actin-R: 5′-CCAGAGGCGTACAGGGATAG-3′
[0088] 1.4 Main reagents and consumables
[0089]
[0090] 1.5 Main Instruments
[0091]
[0092]
[0093] 2 methods
[0094] 2.1 Cell culture
[0095] All gastric cancer cell lines were cultured w...
Embodiment 2
[0258] Example 2 Establishment and Identification of Animal Model of Gastric Cancer Liver Metastasis
[0259] 1 material
[0260] 1.1 Cell lines:
[0261] MKN-45-NC-GFP MKN-45-Si-OLFM4
[0262] 1.2 Animals: Balb / c (nu / nu) nude mice, 6-8 weeks old, weighing 18-20g, SPF level, purchased from Animal Center of Chongqing Medical University
[0263] 1.3 Main reagents and consumables
[0264] Matrigel Weiglass Biotechnology (Beijing) Co., Ltd.
[0265] Transwell culture chamber American BD company
[0266] 4% Paraformaldehyde Beijing Suo Lai Bao Company
[0267] 2 methods
[0268] 2.1 Transwell assay to measure cell migration and invasion ability in vitro
[0269] 2.1.1 Determination of migration ability by Transwell chamber method
[0270] (1) Divide cells into 2×10 5 Spread on a 24-well plate per well and culture in 10% FBS-1640 medium at 37°C for 6-8h until the cells adhere to the wall. (morning of the day)
[0271] (2) After 6-8 hours, the 10% FBS-1640 medi...
Embodiment 3
[0325] Example 3 Preliminary study on the mechanism of action of OLFM4 on gastric cancer cells
[0326] 1 material
[0327] 1.1 Cell lines
[0328] MKN-45-NC-GFP MKN-45-Si-OLFM4
[0329] 1.2 Probe design
[0330] The sequence used to synthesize the NF-κB probe is: 5'-AGTTGAGGGGACTTTCCCAGGC-3'.
[0331] 1.3 Main reagents and consumables
[0332] Cytoplasmic and nuclear protein extraction kit American Pierce Corporation NF-κB p65 mouse anti-human monoclonal primary antibody Santa Cruz Corporation NF-κB p-p65(Ser536) rabbit anti-human polyclonal primary antibody Santa Cruz Corporation NF-κB p50 rabbit / goat anti-human polyclonal primary antibody Santa Cruz Corporation IκB-α rabbit anti-human polyclonal primary antibody Santa Cruz Corporation p-IκB-α mouse anti-human monoclonal primary antibody Santa Cruz Corporation GC-1 rabbit anti-human polyclonal primary antibody Santa Cruz Corporation SP1 rabbit anti-h...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap