Breeding method for prolongation of rice fertility stage
A technology of rice growth period and growth period, applied in the field of rice biotechnology breeding, can solve the problems of restricting the mechanization process of hybrid rice seed production, inconsistent growth period, short growth period of sterile line, restorer line, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0031] The test methods used in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.
[0032] The breeding method adopted in one embodiment of the present invention is introduced below.
[0033] 1. Preparation of a recombinant vector for rice Ehd3 gene targeting.
[0034] 1.1, select the nucleotide sequence GCCCCCCACCACCGCGCAAG at positions 17-39 after the translation initiation codon ATG on the first exon of the rice Ehd3 gene (LOC_Os08g01420) AGG , (the underlined part is the 5'-(N) X -NGG part in the NGG-3' structure), as the targeting site.
[0035] 1.2. Synthesize (BGI) forward oligonucleotide chain (Ehd3KO1P1) and complementary reverse oligonucleotide chain (Ehd3KO1P2) according to the selected target site,
[0036] The specific sequence is:
[0037] Ehd3KO1P1: TGTG GCCCCCCACCACCGCGCAAG;
[0038] Ehd3KO1P2: AAAC C...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap