A method for preparing rainbow trout infectious hematopoietic necrosis inactivated vaccine
A technology of hematopoietic organ necrosis and inactivated vaccine is applied in the field of preparation of rainbow trout infectious hematopoietic organ necrosis inactivated vaccine, which can solve the problem that a single cell cannot obtain high titer IHNV antigen and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0022] Preparation of rainbow trout infectious hematopoietic necrosis antigen and its animal immunity experiment and cohabitation challenge protection experiment
[0023] 1. Isolation and identification of IHNV
[0024] 1) Isolation of IHNV
[0025] The diseased material was collected from the rainbow trout farm where the epidemic broke out in Yongdeng, Gansu Province. After grinding and soaking in the virus, it was inoculated with RTG-2 cells grown three days later. Blind passage was carried out at 14°C, and the passage to the tenth generation took five days In case of typical lesions, the cytotoxic solution was collected and frozen for future use.
[0026] 2. Identification of IHNV
[0027] 2.1) Identification of IHNV
[0028] Primers are designed to amplify the partial fragments of the IHNV nucleoprotein gene by RT-PCR, and the designed amplification primers are:
[0029] Upstream IHNs: 5'tcaagggggggagtcctcga3'
[0030] Downstream IHNa: 5'caccgtactttgctgctac3'
[0031...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com