Mouse model capable of monitoring NF (nuclear factor)-kB activity in liver by virtue of in-vivo imaging and construction method of mouse model

A mouse model and liver technology, applied in the field of biology, can solve the problems of less research on regulatory mechanisms, lack of real-time, dynamic modeling, convenient use of animal models, difficulties, etc.

Active Publication Date: 2014-12-24
FIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most of the current research on NF-κB is based on the cellular level, and the research on the regulation mechanism at the real animal level is relatively rare and difficult. The main reason is the lack of real-time, dynamic, easy-to-model, and convenient-to-use animal model

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mouse model capable of monitoring NF (nuclear factor)-kB activity in liver by virtue of in-vivo imaging and construction method of mouse model
  • Mouse model capable of monitoring NF (nuclear factor)-kB activity in liver by virtue of in-vivo imaging and construction method of mouse model
  • Mouse model capable of monitoring NF (nuclear factor)-kB activity in liver by virtue of in-vivo imaging and construction method of mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1. Construction of a mouse model capable of live imaging monitoring of IFN-β activity in the liver

[0036] Using the method of the present invention to construct a mouse model capable of live imaging monitoring of IFN-β activity in the liver, the specific method includes the following steps:

[0037] 1. Construction of recombinant vector pGL3-attB-IFNβ carrying phage integrase recognition site attB gene, IFN-β promoter and firefly luciferase (Fluc) reporter gene

[0038] Using the HepG2 cell genome as a template, the upstream primer IFNBpf:

[0039] AGATCTAATTCTCAGGTCGTTTGCTT and downstream primer IFNBpr:

[0040] Guided by AAGCTTAAAGGTTGCAGTTAGAATGT, utilize high-fidelity PrimeSTAR TM HS DNA polymerase, PCR amplifies the human IFN-β promoter sequence (its nucleotide sequence is as shown in sequence 1 in the sequence listing), after the amplification finishes, carry out 1% agarose gel electrophoresis to the PCR amplification product , reclaim and purify the...

Embodiment 2

[0071] Example 2, Evaluation of the activation of the IFN-β promoter using a mouse model that can monitor IFN-β activity with live imaging

[0072] In order to verify whether the mouse model of live imaging monitoring IFN-β activity in the liver constructed in Example 1 can be used to evaluate the activation of IFN-β in the mouse liver, a pathogen-associated molecular pattern in the signaling pathway produced by IFN-β was selected. poly(I:C) as an inducer. Poly(I:C) was added to normal saline equivalent to 10% of the mouse body weight, and quickly injected (5-8 sec) into the mouse body by hydrodynamic transfection method, and the expression of mouse liver luciferase and The level of IFN-β in serum, specifically: 10 μg of poly(I:C) was delivered to the liver of 3 mice (experimental group), and monitored by live imaging at 4, 8, 12, 24, 48, and 60 hours Fluorescence activity of mouse liver, and 3 control mice were hydrodynamically injected with normal saline at the same time. ...

Embodiment 3

[0075] Example 3. Evaluation of IFN-β Promoter Inhibition Using a Mouse Model That Can Live Imaging Monitor IFN-β Activity in the Liver

[0076]HCV NS3 / 4A protease is a known inhibitor of the IFN-β activation signaling pathway. Studies at the cellular level have demonstrated that HCV NS3 / 4A protease can block the IFN-β activation signal by cleaving MAVS in human cells conduction. The mouse model for monitoring IFN-β activity by in vivo imaging constructed in Example 1 was used to evaluate the inhibitory effect of HCV NS3 / 4A protease on IFN-β. Two groups of plasmids of pCI-neo (control group, purchased from Promega) and pCI-HCV NS3 / 4A (experimental group, constructed by inserting HCV NS3 / 4A into the pCI-neo vector) were transfected into Example 1. In the liver of a mouse model constructed by in vivo imaging to monitor IFN-β activity, 10 μg of poly(I:C) (or normal saline) was used to stimulate IFN-β activation 24 hours later, and fluorescein was monitored by in vivo fluorescenc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention discloses a mouse model capable of monitoring NF (nuclear factor)-kB activity in the liver by virtue of in-vivo imaging and a construction method of the mouse model. The construction method comprises the following steps: constructing a recombinant vector which carries a phage integrase recognition site attB gene, an NFkB gene and an Fluc (firefly luciferase) reporter gene, and introducing the recombinant vector into the mouse body by virtue of a hydrodynamic method to obtain the mouse model, wherein the Fluc reporter gene regulated and expressed by the NFkB gene is integrated in the liver of a mouse. The mouse model disclosed by the invention can be used for evaluating the adjustment effects of different factors on the NF-kB activity in vivo, also can be used as an evaluation model of interferon or inflammatory factor regulating medicaments, molecules and viruses in natural immunity, and can be widely applied to various categories of biomedical animal experiments.

Description

[0001] The present invention is a divisional application with an application date of December 26, 2011, application number 201110441969.9, and the title of the invention "a mouse model capable of in vivo imaging monitoring of IFN-β or NF-κB activity in the liver and its construction method". technical field [0002] The invention belongs to the animal model and its construction method in the field of biology, in particular to a mouse model capable of live imaging monitoring of NF-κB activity and its construction method. Background technique [0003] Type I interferon (Interferon, IFN) plays an important role in natural immune response, and its main members are IFN-α and IFN-β. The liver is an important place for protein synthesis and activation of many natural immune components. Many immune-related molecules can Activated by signals derived from hepatocytes, what effect the liver's innate immune system plays in hepatitis virus infection and its immunopathogenicity has become ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85A01K67/027
Inventor詹林盛周勇阎少多贾帅争
OwnerFIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY