Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

A kind of drought-inducible promoter and its application

A drought-inducible, promoter technology, applied in the field of non-coding nucleic acids, can solve the problem of few inducible promoters

Inactive Publication Date: 2016-11-30
YANGTZE UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, there are still few inducible promoters that can be used in transgenic research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of drought-inducible promoter and its application
  • A kind of drought-inducible promoter and its application
  • A kind of drought-inducible promoter and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1: The drought-inducible promoter of the present invention pCD4 separation

[0022] 1.1 Preparation of sweet buckwheat genomic DNA

[0023] The sweet buckwheat seedlings with the culture substrate are 8000LUX under the light condition, and the temperature is 25 o C conditions for 3 weeks. Then the light conditions were changed to 8000LUX, and then the DNA was extracted using the new plant genomic DNA rapid extraction kit (catalogue number DN15) of Beijing Aidelai Biotechnology Co., Ltd.

[0024] 1.2 Promoter pCD4 Cloning and sequence analysis of

[0025] Using the DNA extracted above as a template, the upstream promoter sequence of the FeDREB1 gene was amplified by PCR. The amplification primers are as follows, a HindⅢ restriction site is introduced into the upstream primer, and a BamhⅠ restriction site is introduced into the downstream primer:

[0026] Upstream primer: 5'- CCCAAGCTTAAGGTTCTTTGCAAGTC -3'

[0027] Downstream primer: 5'- GCGGATCCGATC...

Embodiment 2

[0041] Example 2: Promoter pCD4 Construction of Plant Transient Expression Vector

[0042] Using Bam HI and Hind III Endonuclease digestion of the recombinant cloning vector (T+ pCD4 )and pC0390::GUS Carrier ( figure 2 , image 3 ), then the Promoter pCD4 and pC0390::GUS The GUS reporter gene of the vector is connected to construct a plant transient expression vector. The constructed plant transient expression vector was named as pCD4::GUS . pC0390::GUS carrier and pC35S::GUS The carrier was provided by Dr. Xu Weirong of Ningxia University, and the specific construction process can be found in literature (Xu et al., 2010, Planta, 231:475–487). Using the electric shock method, the constructed pCD4::GUS carrier, pC0390::GUS vehicle (negative control) and pC35S::GUS The vector (positive control) was respectively introduced into the Agrobacterium tumefaciens competent strain GV3101 for future use.

Embodiment 3

[0043] Example 3: To identify promoters under drought conditions pCD4 active

[0044] 3.1

[0045] 3.1.1 Tobacco culture and transient transformation

[0046] After being treated at 4°C for 1 week, the seeds of Nicotiana benthamiana were sown in the sterilized substrate of the nutrient bowl, covered with plastic wrap, grown in the seedling hardening room for 3 weeks, and then transferred to the artificial intelligence climate incubator after emergence. Tobacco plants grown for 5 weeks in an incubator were used for Agrobacterium-mediated transient transformation assays. The specific transformation method is as follows: ① Inoculate 20 μl of Agrobacterium containing promoter and GUS fusion construct in 20 mL of fresh LB liquid medium, add rifampicin 50 mg L -1 , Kan 50mg L -1 , cultured overnight on a constant temperature shaker at 28°C at 240rpm; ②Transfer the overnight cultured Agrobacterium to a 50mL sterilized centrifuge tube, centrifuge at room temperatu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a drought induced type promoter and application thereof, and in particular relates to a gene expression regulation non-coding nucleic acid in DNA recombinant technology. The drought induced type promoter has a nucleotide sequence of SEQIDNO:1. The drought induced type promoter can provide experimental and technical supports for research and development of a plant bioreactor. Through use of the drought induced type promoter, a plant as a bioreactor can be used for expression of vaccine, antibody and other pharmaceutical proteins and the like, can break through the traditional agriculture category, and extends to the field of medicines.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a non-coding nucleic acid for regulating gene expression in DNA recombination technology. Background technique [0002] In the study of plant genetic engineering, it has become an important method to express foreign target genes in receptors to improve the resistance of crops to adversity stresses such as drought, low temperature, salinity, and pests and diseases, or to improve crop quality and crop agronomic traits. An important means of crop breeding at present. The regulation of gene expression in eukaryotes includes pre-transcriptional regulation, transcriptional regulation, post-transcriptional regulation, translational regulation and post-translational regulation. Among them, the regulation of transcription level is coordinated by cis-acting elements and transcription factors, which is the key link of expression regulation. Therefore, the isolation and resea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/84A01H5/00
Inventor 方正武刘志雄王彩丽李晓方
Owner YANGTZE UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com