Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Liver cancer correlated leucine rich repeat and sterile alpha motif containing 1 gene methylation locus and application thereof

A technology of methylation and alpha, applied in the field of methylation determination of ribonucleic acid (ribonucleic acid) methylation sites in liver cancer, can solve problems such as no research reports.

Inactive Publication Date: 2014-12-31
杨小丽
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The relationship between LRSAM-specific DNA site methylation and liver cancer has not been reported at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Liver cancer correlated leucine rich repeat and sterile alpha motif containing 1 gene methylation locus and application thereof
  • Liver cancer correlated leucine rich repeat and sterile alpha motif containing 1 gene methylation locus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0018] The present invention will be described in further detail below in conjunction with the accompanying drawings and specific embodiments.

[0019] 1. Analysis of heterosexual loci

[0020] Using the Infinium HumanMethylation27 BeadChip methylation chip to screen the difference between the methylation profiles of primary hepatocellular carcinoma and corresponding paracancerous tissues, it was found that in the genomic DNA of primary hepatocellular carcinoma, the promoter region of the LRSAM1 gene The methylation level of one site (number of the site in the methylation chip: (cg05840553)) was significantly lower than that of the paracancerous group. The sequence of the specific site is (SEQ ID No.1):

[0021] GGCATGAGAGACACAGCCTGCCACATTAACTGCTAGGTTTACATCTACAACACAGCTGGAAA[CG]CTCACTGGATTCTTCACCCACACCCCGTTTAATCTCCCAACAACGCCATGCCCACTT CCTG

[0022] In order to test the accuracy of the screening results, relevant specific primers were designed, and the specificity of the specif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses related to a liver cancer correlated leucine rich repeat and sterile alpha motif containing 1 (LRSAM1) gene methylation locus and application thereof. The invention is characterized in that a pyrosequencing method is used for quantitative determination of methylation level of a liver cancer correlated human LRSAM1 gene specific locus cg05840553; unique primers are designed, PCR amplification primers and methylation sequencing primers are provided, the PCR upstream primer has a sequence of 5,-GGGAAGTTAGTAGTTGTTTAGTAGGTATG-3, a downstream primer has a sequence of biotin-5,-ACTTAAAAACATTAAACAACCAACATCTA-3, and a methylation sequencing primer has a sequence of 5,-ATATTTATAATATAGTTGGAA-3. The invention can be used for screening of specific locus of LRSAM1 gene in patients with primary hepatocellular carcinoma, and pyrosequencing PCR primers and methylation sequencing primers aiming at the locus are designed, and pyrosequencing technology can rapidly and accurately conduct quantitative detection on methylation level of the specific locus.

Description

technical field [0001] This study involves quantitative information on the methylation of leucine rich repeat and sterile alpha motif containing 1 (LRSAM1) gene-specific DNA (deoxyribonucleic acid) methylation sites in liver cancer Specifically, the use of pyrosequencing technology found that the specific DNA methylation site of LRSAM1 gene (cg05840553) was reduced in the degree of methylation in liver cancer. In order to understand the pathogenesis of liver cancer and find tumors with potential clinical significance Provide support for prevention and treatment targets. Background technique [0002] Liver cancer is one of the common malignant tumors in my country, and it is the second cancer "killer" in my country. At present, the treatment of liver cancer is mainly based on surgery, radiotherapy and chemotherapy, combined with other treatment methods, such as immunotherapy, traditional Chinese medicine, etc.; however, due to the unclear pathogenesis of liver cancer and the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6869C12Q1/6886C12Q2600/154C12Q2531/113C12Q2565/301
Inventor 杨小丽何敏刘坤张成东张悦宁
Owner 杨小丽
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com