Multivalent meningococcal conjugates and methods of making conjugates

A technology of meningococcus and conjugates, applied in the field of conjugates

Active Publication Date: 2020-10-09
US DEPT OF HEALTH & HUMAN SERVICES +1
View PDF14 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Also, if used as a vaccine, there is the potential for it to induce an autoimmune response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multivalent meningococcal conjugates and methods of making conjugates
  • Multivalent meningococcal conjugates and methods of making conjugates
  • Multivalent meningococcal conjugates and methods of making conjugates

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0119] C. Preparation of Multivalent Immunogenic Conjugates

[0120] In some embodiments, the disclosed methods use multiple immunogenically distinct polysaccharides and / or multiple proteins to prepare multivalent immunogenic conjugates. For example, using the methods described above to conjugate a mixture of two or more (eg 2, 3, 4, 5 or more) immunogenically distinct polysaccharides (eg a plurality of immunogenically distinct polysaccharides) to at least one Protein (eg fHbp or NspA). In some examples, the plurality of immunogenically distinct polysaccharides includes two or more meningococcal polysaccharides (e.g., two or more meningococcal polysaccharides selected from serotypes A, B, C, W-135, and Y). cocci polysaccharide). In a specific example, the plurality of polysaccharides with different immunogenicity comprises meningococcal serogroup A polysaccharide (MAPS), meningococcal serogroup C polysaccharide (MCPS), meningococcal serogroup W-135 polysaccharide (MWPS ) an...

Embodiment 1

[0153] Preparation of conjugates

[0154] method

[0155] MAPS is produced by SynCo BioPartners, Amsterdam, The Netherlands. MCPS was from FioCruz, BioMaguinhus, Brazil. MWPS and MYPS were from Chiron (Emoryville, CA). Tetanus toxoid (TT) was obtained from Wyeth Vaccines and Serum Institute, India. 1-Cyano-4-dimethylaminopyridine tetrafluoroborate (CDAP) was purchased from Sigma-Aldrich (St. Louis, MO).

[0156] The fHbpl gene was amplified by PCR using genomic N. meningitidis H44 / 76 genomic DNA as template, forward primer AAGCTTCCTCGAGTGAGCAGTGGAGGGGGTGGTGTCGCC (SEQ ID NO: 9) and reverse primer GGCGGGGAATTCACTTATTGCTTGGCGGCAAGGCCGAT (SEQ ID NO: 10). The fHbp2 gene was amplified by PCR using genomic N. meningitidis 7608 genomic DNA as template, forward primer AAGCTTCCTCGAGTGAGCAGTGGAGGCGGCGGTGTCGCC (SEQ ID NO: 11 ) and reverse primer GGCGGGGAATTCACTTACTACTGTTTGCCGGCGATGCC (SEQ ID NO: 12). The PCR product was cloned into the XhoI-EcoRI site of the pT7-MAT-Tag-Flag-1 vector...

Embodiment 2

[0165] Immunogenicity of fHbp conjugates

[0166] method

[0167] Groups of 5 or 10 NIH-Swiss mice were immunized subcutaneously on days 0, 14 and 28 with 0.1 mL inoculum containing the conjugate prepared in Example 1 or fHbp and serum was collected on day 35 and natural PS mixture (control).

[0168] Will 1B plate (Dynatech) was coated for 2 hours with 100 μL of coating solution containing PBS (pH 7.4), mixed with methylated human serum albumin (5 μg / mL) or 1 μg / mL fHbp1 or fHbp2 Native MnA, C, W135 or Y PS (5 μg / mL), and washed with 150 μL wash buffer (PBS, pH 7.4, 0.05% 20 and 0.02% NaN 3 ) washed three times. Serum samples or reference serum (specified with 3200 units / mL anti-Mn A, C, W135 or Y PS antibodies, or 32000 units / mL anti-fHbp1 or fHbp2 antibodies) were diluted with dilution buffer (PBS, pH 7.4, 4 % newborn calf serum, 0.02% NaN 3 ) dilutions, a series of two-fold dilutions starting from 1:200. 100 μL of these diluted samples were added to each well of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Meningococcal immunogenic conjugates that elicit immune responses against meningococcal polysaccharides (PS) from groups A, C, W-135 and Y and group B factor H binding protein (fHbp) are disclosed herein. The disclosed conjugates also exhibit bactericidal activity against meningococcal A, C, W-135, Y, B and X serogroups. Also disclosed is an improved method of preparing a conjugate, eg, an immunogenic conjugate, comprising activating the polysaccharide with a cyanating agent at about 4°C.

Description

[0001] Cross References to Related Applications [0002] This application claims priority to US Provisional Application No. 61 / 651,382, filed May 24, 2012, which is incorporated herein by reference in its entirety. technical field [0003] The present disclosure relates to conjugates, in particular immunogenic meningococcal conjugates, and methods of making said conjugates. Background technique [0004] Among the 13 isolated meningococcal serogroups, A, B, C, W-135, and Y were the most prevalent. There are three FDA-approved capsular polysaccharide (PS)-based vaccines— Quadrivalent PS vaccine (Sanofi Pasteur), (Sanofi Pasteur) and (Novartis) tetravalent conjugate vaccine for protection against meningococcal disease caused by group A, C, W-135 and Y Neisseria meningitidis. Group B capsular PS—polysialic acid with α2→8 glycosidic linkages—is structurally similar to PS expressed in certain human tissues (Finne et al., Lancet 2:355-357, 1983), making it a Poor immunogen....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/095A61K39/116A61K39/385A61K39/39A61P37/04A61P31/04
CPCA61K47/646A61K39/095A61P31/04A61P37/04Y02A50/30A61K2039/572A61K2039/70
InventorC-H·R·李V·B·品托
OwnerUS DEPT OF HEALTH & HUMAN SERVICES