HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection

A technology of microsporidia and silkworm, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of detection interference, less sensitivity of primers, low sensitivity, etc., and achieve the effect of increasing range, convenient use, and wide application range

Active Publication Date: 2015-04-08
SOUTH CHINA AGRI UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the target genes of the primers designed in the research of silkworm microsporidian PCR detection technology are also SSUrRNA, and the primers designed for other microsporidian genes are less or have poor sensitivity, so they are rarely reported
Baker et al (1995) and Terry et al (1999) designed PCR primer V1f / 530r based on the highly conserved region of SSU rRNA of similar species of Microsporidia, which can identify DNA templates of various species of Microsporidia and amplify about 450bp Specific target bands, but not specific to Bombyx mori Microsporidia, and the inventors found that using this primer to detect silkworm egg Microsporidia, the detection sensitivity is extremely low, suggesting that there may be a certain Inhibitory factors interfere with PCR amplification of DNA from No.
On the other hand, microsporidia parasitize in silkworm eggs, and the content of silkworm eggs is significantly higher than that of the microsporidia to be detected. In the extracted DNA samples, both DNAs exist at the same time, and the DNA of silkworm silkworm eggs seriously affects the detection. Interference, therefore, if you want to directly use silkworm egg DNA as a template for the detection of microsporidia, higher requirements are put forward for the detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection
  • HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection
  • HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Microsporidia Bombyx mori HMG 1 Gene

[0040] 1. According to the method of gene homologous cloning in the gene cloning technology of molecular biology, No. silkworm was cloned and obtained HMG 1 Gene cDNA and full-length DNA sequences.

[0041] 2. Obtaining the full length of cDNA, the specific method is as follows:

[0042] (1) Using Primer premier 5.0 software, combined with comprehensive analysis, the primers primers HMG1F / HMG1R were designed, and the sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0043] Upstream primer HMG1F (SEQ ID NO.3):

[0044] 5' ATGACTGCTCAAAAAGACGATAC 3'

[0045] Downstream primer HMG1R (SEQ ID NO.4):

[0046] 5'TTATTCATCACTATTCTCCTACTTCT 3'.

[0047] (2) Using the purified spore DNA of N.b. silkworm (N.b) as a template, PCR amplification was performed with primers HMG1F / HMG1R.

[0048] (3) The PCR product was purified, connected to pMD19T, and transformed into E, coli DH-5α for culture.

[0049] ...

Embodiment 2

[0053] Example 2 Detection primer design and establishment of PCR amplification method

[0054] 1. Primer design

[0055] Bombyx mori HMG 1 On the basis of genes, multiple pairs of primers were designed by using Primer premier 5.0 software. Through a large number of drug resistance, specificity and sensitivity tests, three pairs of primers were finally selected as representative primer sets. The primer sequences of each set are as follows:

[0056] (1) The first pair:

[0057] Upstream primer HMG1F (SEQ ID NO.3):

[0058] 5' ATGACTGCTCAAAAAGACGATAC 3'

[0059] Downstream primer HMG1R (SEQ ID NO.4):

[0060] 5'TTATTCATCACTATTCTCCTACTTCT 3'.

[0061] (2) The second pair:

[0062] Upstream primer HMG1-sF (SEQ ID NO.5):

[0063] TTCCGAAATAATCTTCTTTTAATTG

[0064] Downstream primer HMG1-sR (SEQ ID NO.6):

[0065] TTGTGCACCGAATCGTAAATAG

[0066] (3) The third pair:

[0067] Upstream primer HMG1-xF (SEQ ID NO.7):

[0068] TCCCTAGGAACTTTTAAAGAGAAG

[0069] Downstream...

Embodiment 3

[0091] Example 3 Primer Specific Detection

[0092] 1. Using the DNA of No. silkworm (N.b), No. tussah mori (N.a), and No. corn borer (N.f) as templates, primers HMG1F / HMG1R, HMG1-sF / HMG1-sR, HMG1-xF / HMG1-xR, carry out PCR amplification with the method of embodiment 2, agarose gel electrophoresis detection result after amplification is finished.

[0093] 2. The amplification results of the three pairs of primers are shown in the attached Figure 4~6 shown. The results showed that only primers HMG1-sF / HMG1-sR could specifically detect Bombyx mori microsporidia, while primers HMG1F / HMG1R and primers HMG1-xF / HMG1-xR could detect all microsporidia, and had good generality. Detectable, but not specific for N. silkworm.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a silkworm microsporidia HMG1 gene as well as a specific primer set used for rapidly detecting silkworm microsporidia and application thereof. The primer set comprises an upstream primer HMG1-s and a downstream primer HMG1-sR, wherein a nucleotide sequence of the upstream primer is shown in SEQ ID No.5, and a nucleotide sequence of the lower primer is shown in SEQ ID NO.6. A target gene of the detection primer is a high mobility protein gene HMG1 related to sex of the silkworm microsporidia, when the high mobility protein gene HMG1 is taken as the target gene for a silkworm tissue, especially silkworm egg microsporidia molecular detection, the characteristics of reliable detection result, easy operation, strong specificity and high sensitivity can be realized, and the high mobility protein gene HMG1 can be applied to high-sensitivity and rapid silkworm microsporidia molecular detection, especially early detection of the silkworm microsporidia, and has great significance in practical application.

Description

technical field [0001] The invention belongs to the technical field of insect pathogenic microorganism molecular detection. More specifically, it involves HMG1 Genes and their application in the molecular detection of Microsporidium silkworm. Background technique [0002] The study of silkworm microsporidiosis (also known as silkworm microsporidiosis) began with the national epidemic of microsporidiosis in France in 1845. Pasteur determined that the "particles" he observed were the causative factors of microsporidiosis, and later Balbiani identified it as Microsporidium silkworm Nosema bombycis (J.V. Maddox et al., 2000). Microsporidia silkworm has two transmission routes, horizontal transmission and vertical transmission, among which vertical transmission causes great harm to the production of silkworm eggs in sericulture production, and at the same time has a great negative impact on the cocoon yield and quality of silk cocoon breeding, seriously It affects the develo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/30C12Q1/68C12N15/11
CPCY02A50/30
Inventor刘吉平宋小景程伟
OwnerSOUTH CHINA AGRI UNIV