Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Adipose tissue-derived stromal cell construction method and application

A technology of mesenchymal stem cells and construction methods, applied in the biological field, can solve the problems of limited number of cells, inability to maintain long-term survival of grafts, slow action of ADSCs, cytokines, etc.

Inactive Publication Date: 2015-04-22
天津市第一中心医院
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The present invention aims to solve the problems in the prior art that there are limited number of cells in the single application of ADSCs, and that ADSCs act slowly in the body, secrete cytokines are limited, and cannot maintain the long-term survival of grafts, etc., and provide an adipose Construction method and application of mesenchymal stem cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adipose tissue-derived stromal cell construction method and application
  • Adipose tissue-derived stromal cell construction method and application
  • Adipose tissue-derived stromal cell construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0040] 1. Construction of pcDNA3.1(+) / ICOS-IgG Fc and pcDNA3.1(+) / OX40-IgG Fc recombinant plasmids

[0041] 1. Primer Design

[0042] According to the NCBI database, the coding sequence of the extracellular region of rat ICOS is as follows:

[0043] GAACTCAATGACTTGGCCAATCACAGGATGTTTTCGTTTCACGATGGAGGTGTACAGATTTCTTGTAACTACCCTGAGACTGTCCAGCAGTTAAAAATGCAGTTGTTCAAAGACAGAGAAGTCCTCTGCGACCTCACCAAGACCAAGGGAAGCGGAAACACCGTGTCCATCAAGAATCCGATGTCCTGTCCATATCAGCTGTCCAACAACAGTGTCTCTTTTTTCCTAGACAACGCAGACAGCTCCCAGGGCAGCTACTTTTTATGCAGCCTGTCGATTTTCGACCCACCCCCTTTTCAAGAAAAGAACCTTAGTGGAGGATATTTGCTTATTTATGAATCCCAGCTTTGTTGCCAGCTGAAGCTTTGGTTACCC

[0044] The coding sequence of the extracellular region of rat OX40 is as follows:

[0045] GTTACAGTGAAGCTCAACTGTGTTAAAGATACCTACCCCAGTGGTCACAAGTGCTGTCGTGAGTGCCAGCCAGGCCATGGTATGGTGAGCCGCTGTGATCACACCAGGGACACTGTATGTCATCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an adipose tissue-derived stromal cell construction method and application, and belongs to the field of biotechnology. The rat OX40 and ICOS extracellular fragment coding region is expanded in vitro, meanwhile, human IgG Fc fragment coding region is expanded, and a recombined OX40Ig and ICOSIg fusion protein expression vector is constructed; the nuclear transfection technology is applied for guiding the expression vector with the OX40Ig and ICOSIg fusion protein into rat ADSCs, and an OX40Ig and ICOSIg gene modified adipose tissue-derived stromal cell is obtained. According to the adipose tissue-derived stromal cell construction method and application, the immunomodulatory effect of the adipose tissue-derived stromal cell can be kept, blocking to the T-lymphocyte activation process co-stimulatory pathway is increased, the gene therapy and cell therapy coordination and promotion effects are improved, the solving method and experimental basis are provided for induction of adipose tissue-derived stromal cell media immune tolerance, a clinical organ transplantation graft rejective reaction and organ transplantation long-term surviving induction, and the application prospect is wide.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a construction method and application of adipose-derived mesenchymal stem cells. Background technique [0002] Kidney transplantation is currently the most effective way to treat end-stage renal disease. In recent years, the one-year and five-year survival rates of transplanted kidneys in my country have been greatly improved, and the quality of life of patients has been significantly improved. In order to ensure the clinical effect of organ transplantation, postoperative patients must use immunosuppressive agents for a long time. However, the immunosuppressive effect of these drugs is non-specific, affecting the function of the recipient's systemic immune cells, resulting in many adverse reactions, including: increasing the risk of postoperative infection and malignant tumors, causing cardiovascular diseases, leading to metabolic disorders and damage to grafts. Directly produce tox...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N5/10A61K48/00A61P37/06
Inventor 王玉亮刘涛穆红江雁姜锦
Owner 天津市第一中心医院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com