Adipose tissue-derived stromal cell construction method and application
A technology of mesenchymal stem cells and construction methods, applied in the biological field, can solve the problems of limited number of cells, inability to maintain long-term survival of grafts, slow action of ADSCs, cytokines, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0039] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.
[0040] 1. Construction of pcDNA3.1(+) / ICOS-IgG Fc and pcDNA3.1(+) / OX40-IgG Fc recombinant plasmids
[0041] 1. Primer Design
[0042] According to the NCBI database, the coding sequence of the extracellular region of rat ICOS is as follows:
[0043] GAACTCAATGACTTGGCCAATCACAGGATGTTTTCGTTTCACGATGGAGGTGTACAGATTTCTTGTAACTACCCTGAGACTGTCCAGCAGTTAAAAATGCAGTTGTTCAAAGACAGAGAAGTCCTCTGCGACCTCACCAAGACCAAGGGAAGCGGAAACACCGTGTCCATCAAGAATCCGATGTCCTGTCCATATCAGCTGTCCAACAACAGTGTCTCTTTTTTCCTAGACAACGCAGACAGCTCCCAGGGCAGCTACTTTTTATGCAGCCTGTCGATTTTCGACCCACCCCCTTTTCAAGAAAAGAACCTTAGTGGAGGATATTTGCTTATTTATGAATCCCAGCTTTGTTGCCAGCTGAAGCTTTGGTTACCC
[0044] The coding sequence of the extracellular region of rat OX40 is as follows:
[0045] GTTACAGTGAAGCTCAACTGTGTTAAAGATACCTACCCCAGTGGTCACAAGTGCTGTCGTGAGTGCCAGCCAGGCCATGGTATGGTGAGCCGCTGTGATCACACCAGGGACACTGTATGTCATCC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
