Preparation method of human T cell carrying anti-Her2/CD3 bispecific function protein

A bispecific antibody and host cell technology, applied to cells modified by introducing foreign genetic material, hybrid immunoglobulins, antibodies, etc., can solve the problems of deletion, residual tumor cell tumor recurrence, etc., and achieve good safety Effect

Active Publication Date: 2015-08-12
FUDAN UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Her2 monoclonal antibody therapy: For example, Trastuzumab (Herceptin) has achieved certain curative effect in the treatment of some Her-positive tumors, but due to the lack of effector immune cells, it is difficult to completely clear the residual tumor cells and prevent tumor recurrence by simple antibody therapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of human T cell carrying anti-Her2/CD3 bispecific function protein
  • Preparation method of human T cell carrying anti-Her2/CD3 bispecific function protein
  • Preparation method of human T cell carrying anti-Her2/CD3 bispecific function protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] ① Preparation of target gene:

[0062] a. The anti-Her2 antibody sequence is derived from the humanized antibody in the literature (Humanization of an anti-p185HER2 antibody for human cancer therapy. Proc. Natl. Acad. Sci. USA, 1992, 89: 4285-4289.): light chain segment huMAb4D5 -5VL and heavy chain segment huMAb4D5-5VH (such as figure 1 Shown).

[0063] The VL sequence of the anti-Her2 antibody used in the examples of the present invention is as follows:

[0064] The nucleic acid sequence is shown in SEQ ID No. 1:

[0065] ATGGATTTTCAGGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCAGTCATAATGTCCAGAGGAGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGATAGGGTCACCATCACCTGCCGTGCCAGTCAGGATGTGAATACTGCTGTAGCCTGGTATCAACAGAAACCAGGAAAAGCTCCGAAACTACTGATTTACTCGGCATCCTTCCTTGAGTCTGGAGTCCCTTCTCGCTTCTCTGGATCTAGATCTGGGACGGATTTCACTCTGACCATCAGCAGTCTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAACATTATACTACTCCTCCCACGTTCGGACAGGGTACCAAGGTGGAGATCAAA (SEQ ID No.1)

[0066] The protein sequence is shown in SEQ ID No. 2:

[006...

Embodiment 2

[0141] Based on the above results, we chose the VL-VH method for the 4D5 single-chain structure, and then we further replaced the linker between 4D5VL and 4D5VH, and the linker between 4D5 and OKT. The following six structures were prepared

[0142] (1)OA:VL-(G4S)3-VH-GGGGSDIK-OKT

[0143] The nucleic acid sequence is shown in SEQ ID No. 34:

[0144] ATGGATTTTCAGGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCAGTCATAATGTCCAGAGGAGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGATAGGGTCACCATCACCTGCCGTGCCAGTCAGGATGTGAATACTGCTGTAGCCTGGTATCAACAGAAACCAGGAAAAGCTCCGAAACTACTGATTTACTCGGCATCCTTCCTTTATTCTGGAGTCCCTTCTCGCTTCTCTGGATCTAGATCTGGGACGGATTTCACTCTGACCATCAGCAGTCTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAACATTATACTACTCCTCCCACGTTCGGACAGGGTACCAAGGTGGAGATCAAAggcggagggggaagtggcgggggtgggtccggcggcggcggctcgGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCAGGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACATTAAAGACACCTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCAAGGATTTATCCTACGAATGGTTATACTAGATATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the biotechnical field, and especially relates to a bispecific antibody. The bispecific antibody comprises a first antibody segment and a second antibody segment, the first antibody segment is an antitumor antigen-antibody segment, and the second antibody segment is an anti-human CD3 molecule antibody segment. A bispecific antibody principle is used to construct the Her2 tumor antigen and T cell specific bispecific antibody, and adoptively transferred T cells are used to carry and continuously express the antibody protein in vivo, so the bispecific antibody has an in vivo killing effect, generates enough T effect effects, and optimizes the effect performance efficiency.

Description

Technical field [0001] The present invention relates to the field of biotechnology, in particular to a bispecific antibody. Background technique [0002] Bispecific antibody: It is formed by directly connecting two antibodies. The current common preparation method is as follows: Reference PNAS,2013,110(1):270-275. [0003] First, PCR was used to prepare the bispecific antibody gene, and then this gene was cloned into the expression vector pRB199 and transformed into E. coli strain BL21 (λDE3). The bacteria were inoculated into a broth medium containing 80μg / ml chloramphenicol and cultured at 37°C until the absorbance at A600 reached 2.0. Add 0.1 mM isopropyl-β-D-thiogalactopyranoside (isopropylβ-D-1-thiogalactopyranoside) to the medium to induce the expression of the recombinant bispecific antibody, and continue to culture at 37°C for 4 hours. The bacterial solution was centrifuged at 2000g for 15 minutes to collect the bacteria, and resuspend the bacteria in TE50 / 20 buffer [50mM...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/46C12N15/13C12N15/85C12N5/10A61K39/395A61K48/00A61P35/00
Inventor储以微骆菲菲杨姣钱嘉文郑秀娟
OwnerFUDAN UNIV