Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of long noncoding RNA HNF1A-AS1 ((hepatocyte nuclear factor-1Alpha Antisense 1) in preparation of drugs for treating human malignant solid tumors

A technology of RNAHNF1A-AS1 and HNF1A-AS1, which can be used in the field of new targets for the treatment of malignant solid tumors, and can solve problems such as incomplete sequences

Inactive Publication Date: 2015-11-25
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the sequence of HNF1A-AS1 published in literature or database is incomplete
[0007] There is no literature report that HNF1A-AS1 can be used to treat malignant tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of long noncoding RNA HNF1A-AS1 ((hepatocyte nuclear factor-1Alpha Antisense 1) in preparation of drugs for treating human malignant solid tumors
  • Application of long noncoding RNA HNF1A-AS1 ((hepatocyte nuclear factor-1Alpha Antisense 1) in preparation of drugs for treating human malignant solid tumors
  • Application of long noncoding RNA HNF1A-AS1 ((hepatocyte nuclear factor-1Alpha Antisense 1) in preparation of drugs for treating human malignant solid tumors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1: Real-TimePCR detection of human liver tumor cell line HNF1A-AS1 gene expression

[0067] 1. The commercially available conventional liver tumor cell lines HepG2, Huh7, Hep3B, MHCC-L, MHCC-H, LM3, PLC, and Focus were all mixed at 5×10 5 Inoculated in a six-well plate per plate, cultured with fresh culture medium containing 10% fetal bovine serum, extracted cellular RNA the next day, measured OD260 value with a spectrophotometer, and detected RNA integrity by 1% agarose gel electrophoresis.

[0068] 2. Real-Time PCR:

[0069]Add 1 μg RNA to 4 μl 5×PrimeScript RT mastermix (reverse transcription kit), add DEPC water to make up the volume to 20 μl, react at 37°C for 15 minutes; react at 85°C for 5s to inactivate reverse transcriptase, and the reverse transcription product can be obtained. After diluting the reverse transcription product, take 1 μl as a template for HNF1A-AS1 PCR amplification, and use β-actin as an internal reference to perform PCR reaction unde...

Embodiment 2

[0078] Example 2: Detection of the expression of HNF1A-AS1 in liver cancer tissues and their corresponding paracancerous tissues by Real-TimePCR

[0079] The postoperative liver cancer tissues of 53 patients with liver cancer were collected (source of samples: Oriental Hepatobiliary Surgery Hospital), RNA was extracted by Trizol method, OD260 value was measured by spectrophotometer, and RNA integrity was detected by 1% agarose gel electrophoresis.

[0080] According to the RNA reverse transcription method in Example 1, the cDNA of the liver cancer tissue specimen was obtained by reverse transcription, and after the cDNA was diluted, the expression of HNF1A-AS1 in the human liver cancer tissue was detected according to the same method and conditions as described above in Example 1, and at the same time, the expression of β-actin gene The expression status was used as an internal reference, and the results showed that the expression of HNF1A-AS1 was down-regulated in liver cancer...

Embodiment 3

[0081] Example 3: Rapid amplification of cDNA ends (rapid amplification of cDNA ends, RACE) amplifies the full length of the HNF1A-AS1 gene

[0082] According to the known sequence of HNF1A-AS1, the 5' end specific amplification primer (5'GSP) AACTCGGACTGTTTCTCCTTCCCACCCC (SEQ ID NO:6) and the 3' end specific amplification primer (3'GSP) ACGGCTAGTAAACGGCAGAACGAGGC (SEQ ID NO:7) were designed respectively, Synthetic primers.

[0083] Marathon using commercially available CLONTECH TM The kit amplifies the cDNA sequence of the HNF1A-AS1 gene. The kit includes adapter primers and prefabricated human liver cDNA. The following PCR system is used for amplification.

[0084] PCR amplification system:

[0085]

[0086] Mix the components, centrifuge and put them into PCR instrument for amplification reaction.

[0087] Reaction conditions: 94°C, 5min; 94°C for 30sec, 70°C for 30s, 72°C for 1min, 40 cycles; 72°C for 7min, 4°C∞.

[0088] The 5' end and 3' end fragments of HNF1A-AS1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene therapy and medical diagnosis and provides application of long noncoding RNA HNF1A-AS1 (hepatocyte nuclear factor-1Alpha Antisense 1) in the preparation of drugs for treating human malignant solid tumors. Studying shows that by controlling gene expression of malignant solid tumor cells HNF1A-AS1, proliferation of the malignant solid tumors can be effectively inhibited, and thereby a novel target is provided for the clinical treatment of malignant solid tumors.

Description

technical field [0001] The present invention relates to the fields of gene therapy and medical diagnosis. Specifically, the present invention relates to the application of a long-chain non-coding RNA HNF1A-AS1 (HepatocyteNuclearFactor-1αAntisense1) in the preparation of medicines for treating human malignant solid tumors, and provides a method for treating malignant solid tumors. new target. Background technique [0002] The treatment of malignant solid tumors is one of the current clinical difficulties, especially for malignant solid tumors that cannot be removed by surgery, there is still a lack of effective treatment methods in clinic. Selecting key molecules and genes closely related to the occurrence and development of tumor cells for specific targeted regulation is one of the core issues in the treatment of malignant solid tumors. [0003] Long non-coding RNA (long noncoding RNA, lncRNA) is a type of RNA molecule with a transcript length of more than 200 nt (nucleotid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61K31/7105A61K31/7088A61P35/00
CPCA61K31/7088A61K31/7105A61K48/00
Inventor 张新丁晨虹谢渭芬文良志陈斐
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY