Application of long noncoding RNA HNF1A-AS1 ((hepatocyte nuclear factor-1Alpha Antisense 1) in preparation of drugs for treating human malignant solid tumors
A technology of RNAHNF1A-AS1 and HNF1A-AS1, which can be used in the field of new targets for the treatment of malignant solid tumors, and can solve problems such as incomplete sequences
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Example 1: Real-TimePCR detection of human liver tumor cell line HNF1A-AS1 gene expression
[0067] 1. The commercially available conventional liver tumor cell lines HepG2, Huh7, Hep3B, MHCC-L, MHCC-H, LM3, PLC, and Focus were all mixed at 5×10 5 Inoculated in a six-well plate per plate, cultured with fresh culture medium containing 10% fetal bovine serum, extracted cellular RNA the next day, measured OD260 value with a spectrophotometer, and detected RNA integrity by 1% agarose gel electrophoresis.
[0068] 2. Real-Time PCR:
[0069]Add 1 μg RNA to 4 μl 5×PrimeScript RT mastermix (reverse transcription kit), add DEPC water to make up the volume to 20 μl, react at 37°C for 15 minutes; react at 85°C for 5s to inactivate reverse transcriptase, and the reverse transcription product can be obtained. After diluting the reverse transcription product, take 1 μl as a template for HNF1A-AS1 PCR amplification, and use β-actin as an internal reference to perform PCR reaction unde...
Embodiment 2
[0078] Example 2: Detection of the expression of HNF1A-AS1 in liver cancer tissues and their corresponding paracancerous tissues by Real-TimePCR
[0079] The postoperative liver cancer tissues of 53 patients with liver cancer were collected (source of samples: Oriental Hepatobiliary Surgery Hospital), RNA was extracted by Trizol method, OD260 value was measured by spectrophotometer, and RNA integrity was detected by 1% agarose gel electrophoresis.
[0080] According to the RNA reverse transcription method in Example 1, the cDNA of the liver cancer tissue specimen was obtained by reverse transcription, and after the cDNA was diluted, the expression of HNF1A-AS1 in the human liver cancer tissue was detected according to the same method and conditions as described above in Example 1, and at the same time, the expression of β-actin gene The expression status was used as an internal reference, and the results showed that the expression of HNF1A-AS1 was down-regulated in liver cancer...
Embodiment 3
[0081] Example 3: Rapid amplification of cDNA ends (rapid amplification of cDNA ends, RACE) amplifies the full length of the HNF1A-AS1 gene
[0082] According to the known sequence of HNF1A-AS1, the 5' end specific amplification primer (5'GSP) AACTCGGACTGTTTCTCCTTCCCACCCC (SEQ ID NO:6) and the 3' end specific amplification primer (3'GSP) ACGGCTAGTAAACGGCAGAACGAGGC (SEQ ID NO:7) were designed respectively, Synthetic primers.
[0083] Marathon using commercially available CLONTECH TM The kit amplifies the cDNA sequence of the HNF1A-AS1 gene. The kit includes adapter primers and prefabricated human liver cDNA. The following PCR system is used for amplification.
[0084] PCR amplification system:
[0085]
[0086] Mix the components, centrifuge and put them into PCR instrument for amplification reaction.
[0087] Reaction conditions: 94°C, 5min; 94°C for 30sec, 70°C for 30s, 72°C for 1min, 40 cycles; 72°C for 7min, 4°C∞.
[0088] The 5' end and 3' end fragments of HNF1A-AS1...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com