A method for recombinase complex and in vitro homologous recombination seamless cloning
A technology of homologous recombination and seamless cloning, applied in the field of DNA recombination, can solve the problems of high cost, failure, cumbersome and time-consuming steps, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0043] The preparation of the insert fragment PCR product in step 2 includes primer design and PCR amplification.
[0044] 1. Design amplification primers
[0045] The general principle of primer design is: by introducing a homologous sequence at the end of the linearized cloning vector at the 5' end of the primer, the 5' and 3' ends of the amplified product of the insert fragment are completely consistent with those corresponding to the two ends of the linearized cloning vector. The sequence is 15bp-20bp in length.
[0046] Forward amplification primer design method:
[0047] 5'—Homologous sequence at the end of the upstream vector + gene-specific forward amplification sequence—3'
[0048] Reverse amplification primer design method:
[0049] 3'—gene-specific reverse amplification sequence + homologous sequence at the end of the downstream vector—5'
[0050] The gene-specific forward / reverse amplification sequence is the normal insert fragment forward / reverse amplification...
Embodiment
[0080] Embodiment: Effector protein BepC eukaryotic expression plasmid construction
[0081] The nucleic acid sequence of the BepC protein is:
[0082] ATGTTAGAGCATAATTATTTTTATAAAAACAGCGCAACACTGAAGAATAAACATGGCATAAAAAACCCGCGAAAACTGTATGAACGCTGTGCTCATGAGACAGCCAGAGAGGCTGTAAATTTTCGCCTTGAACCGCCACCAGGGAAATTTGATGCCGCTTATCTAAGGACAATTCACTGGTGCCTTTTCCATAAAACTTTTGAATGGGCCGGTGTTACCCGAGATCAGCCCTTTACATTTGAAGATGGCAGCACTGCATGTATGCCAGCTATGCGACCAAAAGGTTATAAGGTTCCTTTTGCTGTCGGTTCACAAATTCAAAGAGAGCTTAAAAAATTAGAACAAAGACTAACCGCGAAGAATAATTTACAAGGCTTATCGCGCCAAGAATTTGCTGCAAATGCTGCTGAAGTTTTTACAGCTCTCGACCACGCGCATCCTTTCAGAAAAGGCAATGGGCGCACACAACGAATGTTTATGGAAAAACTCGGACAAGCGGCAGGCTATAAGATTGATTTTTCTTTGATCACAAAAGAACGCATGACATATGCCAGCATTGAAGCAATGCAACATAACAATCCAGAACCCATGAAAGATCTTTTTGAGGATATCACTCACCCTCAAAAATCCCTTCTTTTAAAGGAATTTATCTCTCAGATGAGAAGCGCTAGACTTGATGAAATTAACAATCATATTGTTTTGGCAGCAAAAGAAGGTGTGACCTATGATGGCATTTATAAAGGTTCTTCAGCTGAAGGTTTTGTTATAGAAGTAGAAGGTGGCACTTTCATCGTCGGGCACAAAGATGATCTTAAGCCAGAGCAAGTGAAAATATTACAGA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


