Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for recombinase complex and in vitro homologous recombination seamless cloning

A technology of homologous recombination and seamless cloning, applied in the field of DNA recombination, can solve the problems of high cost, failure, cumbersome and time-consuming steps, etc.

Active Publication Date: 2019-05-07
YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the actual experimental process, the steps of this method are cumbersome and time-consuming, and different endonucleases need to be selected according to the sequence of the cloned gene, and the cost is high
And some gene cloning rich in special palindromic sequences often fails due to lack of suitable endonuclease sites

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for recombinase complex and in vitro homologous recombination seamless cloning
  • A method for recombinase complex and in vitro homologous recombination seamless cloning
  • A method for recombinase complex and in vitro homologous recombination seamless cloning

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0043] The preparation of the insert fragment PCR product in step 2 includes primer design and PCR amplification.

[0044] 1. Design amplification primers

[0045] The general principle of primer design is: by introducing a homologous sequence at the end of the linearized cloning vector at the 5' end of the primer, the 5' and 3' ends of the amplified product of the insert fragment are completely consistent with those corresponding to the two ends of the linearized cloning vector. The sequence is 15bp-20bp in length.

[0046] Forward amplification primer design method:

[0047] 5'—Homologous sequence at the end of the upstream vector + gene-specific forward amplification sequence—3'

[0048] Reverse amplification primer design method:

[0049] 3'—gene-specific reverse amplification sequence + homologous sequence at the end of the downstream vector—5'

[0050] The gene-specific forward / reverse amplification sequence is the normal insert fragment forward / reverse amplification...

Embodiment

[0080] Embodiment: Effector protein BepC eukaryotic expression plasmid construction

[0081] The nucleic acid sequence of the BepC protein is:

[0082] ATGTTAGAGCATAATTATTTTTATAAAAACAGCGCAACACTGAAGAATAAACATGGCATAAAAAACCCGCGAAAACTGTATGAACGCTGTGCTCATGAGACAGCCAGAGAGGCTGTAAATTTTCGCCTTGAACCGCCACCAGGGAAATTTGATGCCGCTTATCTAAGGACAATTCACTGGTGCCTTTTCCATAAAACTTTTGAATGGGCCGGTGTTACCCGAGATCAGCCCTTTACATTTGAAGATGGCAGCACTGCATGTATGCCAGCTATGCGACCAAAAGGTTATAAGGTTCCTTTTGCTGTCGGTTCACAAATTCAAAGAGAGCTTAAAAAATTAGAACAAAGACTAACCGCGAAGAATAATTTACAAGGCTTATCGCGCCAAGAATTTGCTGCAAATGCTGCTGAAGTTTTTACAGCTCTCGACCACGCGCATCCTTTCAGAAAAGGCAATGGGCGCACACAACGAATGTTTATGGAAAAACTCGGACAAGCGGCAGGCTATAAGATTGATTTTTCTTTGATCACAAAAGAACGCATGACATATGCCAGCATTGAAGCAATGCAACATAACAATCCAGAACCCATGAAAGATCTTTTTGAGGATATCACTCACCCTCAAAAATCCCTTCTTTTAAAGGAATTTATCTCTCAGATGAGAAGCGCTAGACTTGATGAAATTAACAATCATATTGTTTTGGCAGCAAAAGAAGGTGTGACCTATGATGGCATTTATAAAGGTTCTTCAGCTGAAGGTTTTGTTATAGAAGTAGAAGGTGGCACTTTCATCGTCGGGCACAAAGATGATCTTAAGCCAGAGCAAGTGAAAATATTACAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinase complex which is derived from escherichia coli Rec homologous recombinase and comprises RecE, RecT and Gamma proteins. The invention also provides an in-vitro homologous recombination seamless cloning method, and the method only needs to mix a PCR (polymerase chain reaction) product having vector terminal sequences at two ends with a linearization cloning vector in a certain proportion and efficiently and directionally clone target DNA to any site of any vector under the catalysis of the recombinase complex, wherein the cloning positive rate can be not less than 95%. The method provided by the invention is particularly suitable for cloning large DNA fragments, can be used for overcoming the defects of complicated operation, high time consumption, high failure rate and the like of a conventional cloning method, can provide a quick, convenient and efficient cloning method for DNA in-vitro recombination, and lays an important foundation in the aspects of cytological basic research, industrial and agricultural production and medical care.

Description

technical field [0001] The present invention relates to DNA recombination technology in molecular biology, in particular to a nucleic acid molecular cloning method of in vitro homologous recombination and a recombinase complex. Background technique [0002] Modern biological research relies heavily on recombinant DNA technology. The phenomenon of DNA recombination in cells is called in vivo recombination. Due to the development of new technologies, DNA recombination can now be carried out outside the cell by manual manipulation, which is called in vitro recombination. [0003] Obtaining gene cloning through DNA recombination is the basis for studying the structure, function and evolution of genes. Gene cloning technology is also known as molecular cloning technology, recombinant DNA technology, genetic engineering, genetic manipulation or asexual reproduction of genes. In the whole process of gene cloning, the recombination of DNA is a very critical step, which directly d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/12C12N15/63
CPCC12N9/1241
Inventor 方筱玉
Owner YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD