Check patentability & draft patents in minutes with Patsnap Eureka AI!

Compound bacterium and treatment process for heavy-metal sewage treatment

A technology for complex flora and sewage treatment, which is applied in the field of complex flora and its treatment process, can solve the problems of low treatment efficiency and large amount of bacterial solution, and achieve the effects of improving treatment efficiency, reducing treatment costs, and slowing down the decline of bacteria

Active Publication Date: 2016-01-27
SHENZHEN ZHONGNAN ENVIRONMENTAL PROTECTION TECH CO LTD
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the problems of low treatment efficiency and large amount of bacterial solution in the existing bacillus sewage treatment technology, the present invention provides a complex bacterial group for heavy metal sewage treatment and its treatment process, through the laboratory for various heavy metals The Bacillus with adsorption effect was screened and improved, and four excellent strains were cultivated for mixing. Through the synergistic effect between different strains, heavy metals in sewage were adsorbed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compound bacterium and treatment process for heavy-metal sewage treatment
  • Compound bacterium and treatment process for heavy-metal sewage treatment
  • Compound bacterium and treatment process for heavy-metal sewage treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] In this example, the complex flora provided by the present invention is used to adsorb heavy metal sewage. The entire adsorption process lasts for about 10 minutes, and the electron microscope observation is carried out at the same time:

[0038] see figure 1 As shown, it is the electron micrograph of the complex bacterial flora at the initial stage of adsorption. It can be seen from the electron micrograph that the initial state of the bacteria is mostly dispersed individuals and short rod-shaped bamboo joints;

[0039] figure 2 and image 3 This is the electron micrograph of the complex bacterial flora in the middle stage of adsorption. It can be seen from the figure that while the heavy metal adsorption is being carried out, the bacillus cells are connected end to end to gradually form a strip-like bacterial chain, which is presumably due to the adsorption of heavy metal ions on the cell surface. The surface charge effect or the change of the chemical properties o...

Embodiment 2

[0043] 16SrDNA sequence identification is carried out respectively to 4 strain bacterial classifications provided by the present invention, and 16SrDNA is the most useful and the most commonly used molecular clock in the taxonomic research of bacterium, and its kind is few, and content is big (accounting for 80% of bacterial RNA content), molecular It is moderate in size and exists in all organisms. Its evolution has good clock properties and is highly conserved in structure and function, including the following steps:

[0044] Step 1: Select a single bacterial species for cultivation, and extract the bacterial genome after cultivation and expansion;

[0045] Step 2: Perform PCR amplification on the 16S rDNA sequence of the bacterial genome using 16S rDNA primers, the 16S rDNA primers used are 16S-F: AGAGTTTGATCCTGGCTCAG, 16S-R: ACGGCTACCTTGTTACGACTT;

[0046] Step 3: purifying the PCR product;

[0047] Step 4: Obtain the 16SrDNA sequence by DNA sequencing;

[0048] Step 5: ...

Embodiment 3

[0056] This embodiment is used to illustrate the complex flora treatment process of the heavy metal sewage treatment provided by the present invention, comprising the following steps:

[0057] Step 1: preparing a bean sprouts juice medium, inoculating at least one strain of Brevibacterium halotolerans strain CAS17, Bacillus sp.4014, Bacillus megaterium NBRC and Bacillus sp.1PPL-SC1 in the bean sprouts juice medium, Pass the filtered and sterilized air into the culture medium through the air pump, shake it on the shaker for 48 hours, the rotation speed is 200rpm, and the culture temperature is 30°C, until the treated bacterial liquid is golden yellow and viscous, which is the best;

[0058] Step 2: Detect the heavy metal content in the heavy metal wastewater to be treated, dilute with water according to the volume of the heavy metal wastewater, dilute the total heavy metal content to below 1000mg / L, add the same volume of treatment bacteria solution to the diluted heavy metal wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a compound bacterium for heavy-metal sewage treatment. The compound bacterium comprises at least one of Brevibacterium halotolerans strain CAS17, Bacillus sp.4014, Bacillus megaterium NBRC and Bacillus sp.1 PPL-SC1. The four strains are already collected by the China Center for Type Culture Collection on 21st, September, 2015, and collection numbers of the Brevibacterium halotolerans strain CAS17, the Bacillus sp.4014, the Bacillus megaterium NBRC and the Bacillus sp.1 PPL-SC1 are CCTCC No.M2015565, CCTCC No.M2015566, CCTCC No.M2015568 and CCTCC No.M2015567 respectively. The invention further discloses a treatment process for heavy-metal sewage treatment and aims at solving the problems of low treatment efficiency and large consumption of bacterial liquid in existing Bacillus sewage treatment technology.

Description

technical field [0001] The invention relates to a composite bacterial group for heavy metal sewage treatment and a treatment process thereof. Background technique [0002] Heavy metal industrial wastewater is a product associated with the development of modern industry, and it is also a major issue related to social livelihood and social environmental protection that governments at all levels and related industrial enterprises are paying great attention to and making great efforts to manage. At present, the conventional treatment methods mainly include: chemical precipitation method, ion exchange method, evaporation concentration method, electrolysis method, activated carbon and silica gel adsorption method and membrane separation method, etc., but these methods have incomplete removal, high cost, toxic sludge or other Disadvantages such as waste. Microbial treatment method is to use bacteria, fungi (yeast), algae and other biological materials and their life metabolic acti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C02F3/34C12R1/11C12R1/07C12R1/13C02F101/20
Inventor 苑伟东戴泽民
Owner SHENZHEN ZHONGNAN ENVIRONMENTAL PROTECTION TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More