Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

MicroRNA SDA (strand-displacement amplification) detection method based on AgNCs/HpDNA probes

A detection method, the technology of mir-19b-3p, is applied in the field of microRNASDA detection method and dual microRNA detection, which can solve the problems such as difficult to ensure specificity, and achieve the effect of shortening the reaction time and saving reaction materials

Active Publication Date: 2016-01-27
SHANGHAI JIAO TONG UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, although simple hybridization detection is simple, it is difficult to ensure good specificity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MicroRNA SDA (strand-displacement amplification) detection method based on AgNCs/HpDNA probes
  • MicroRNA SDA (strand-displacement amplification) detection method based on AgNCs/HpDNA probes
  • MicroRNA SDA (strand-displacement amplification) detection method based on AgNCs/HpDNA probes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] The present invention will be described in detail below with reference to specific embodiments. The following examples will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0030] The sequence involved in this application is as follows:

[0031] RED16(7s)C (SEQ ID No. 1): tatacgccaatatttacgtgctgctaattggcgtatacccttaatcccc

[0032] hsa-miR-16-5p (SEQ ID No. 2): uagcagcacguaaauauuggcg

[0033] Pri2 (SEQ ID No. 3): gggtggggtggggtggggta

[0034] RED16(7s)G (SEQ ID No. 4): gggtggggtggggtggggtatacgccaattagcagcacgtaaatattggcgtata

[0035] GRE19b(5s)C (SEQ ID No. 5): tatacgtcagttttgcatggatttgcacaactgacgtatacccccccccccccccgcccgcc

[0036] hsa-miR-19b-3p (SEQ ID No. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a microRNA SDA (strand-displacement amplification) detection method based on AgNCs / HpDNA probes, particularly discloses a double SDA detection method for miRNA (microRNA) markers of miR-16-5p and miR-19b-3p of gastric cancer plasma, and more particularly discloses a microRNA detection method based on hairpin DNA-templated silver nanoclusters probes combined with isothermal amplification. According to the method, hairpin DNA-templated silver nanoclusters are used as novel molecular beacons, and in a strand-displacement isothermal amplification reaction mediated by G-rich sequences of flap terminals of primers, double detection of the two miRNA markers of the gastric cancer plasma is achieved by the aid of G-rich fluorescence enhancement effect produced by hybridization. The method is high in specificity, short in reaction time, less in raw material consumption and simple and convenient in operation steps and opens up a new direction for establishing a rapid, simple and convenient novel miRNA detection method.

Description

technical field [0001] The invention relates to the fields of medicine and molecular diagnosis, and is a microRNASDA detection method based on AgNCs / HpDNA probes, in particular to a double microRNA based on a hairpin DNA template to synthesize silver nanocluster probe binding strands to replace isothermal amplification Detection method. Background technique [0002] MicroRNA (miRNA) is a class of endogenous non-coding small RNA molecules with a length of about 21 nt, which can participate in the regulation of mRNA expression levels through precise or non-precise complementary pairing with mRNA. Multiple miRNAs can coordinately regulate one mRNA, or one miRNA can also affect multiple target genes at the same time, thus forming a highly complex regulatory network that affects a series of biological functions from molecule to cell to tissue level. Abnormal expression of miRNA is closely related to disease and cancer. Most importantly, it has been found that a variety of miRNA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6844C12Q2525/207C12Q2525/301C12Q2531/119C12Q2537/143C12Q2563/107
Inventor 崔大祥张晶璞
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com