Fast detection method of PCR amplification products of food pathogenic bacteria

A technology for amplification products and detection methods, which is applied in the field of rapid detection of PCR amplification products of pathogenic bacteria, can solve the problems of high detection cost of real-time fluorescent PCR method, small detection range of pathogenic bacteria, easy to cause pollution, etc., and achieve easy Popularization and application, low cost and high specificity

Inactive Publication Date: 2016-05-04
NINGBO UNIV
View PDF1 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In response to the current situation of food microbial contamination, countries have developed and derived a variety of food microbial detection technologies. At present, the main rapid detection technologies include real-time fluorescent PCR method, fluorescent immunoassay method, PCR-based gel elec

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fast detection method of PCR amplification products of food pathogenic bacteria
  • Fast detection method of PCR amplification products of food pathogenic bacteria
  • Fast detection method of PCR amplification products of food pathogenic bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] A rapid detection method for PCR amplification products of Vibrio parahaemolyticus, the specific steps are as follows:

[0030] (1) Magnetic bead method to extract DNA template of Vibrio parahaemolyticus

[0031] A. Take 1mL of Vibrio parahaemolyticus, centrifuge at 10000r / min for 5min, remove the supernatant, dissolve the precipitate in 1mL of bacterial lysate, shake for 15s, in a water bath at 70℃ for 12min, centrifuge at 5000r / min to obtain 1mL of cell lysate; The formula of bacterial lysate is 50μL 1M Tris-HCl, 50μL 15wt% SDS solution, 50μL 20mg / ml proteinase K, 20μL 0.5M EDTA with pH=5.0, 2μL RNase, make up to 1mL with double distilled water;

[0032] B. Add 10 μL of magnetic nanoparticles to 1 mL of cell lysate, vortex for 5 seconds, then add 600 μL of adsorption buffer to mix, shake for 15 minutes, and magnetically separate the supernatant; the adsorption buffer consists of 80 μL of 9wt% polyethylene glycol Mixing 20000 solution and 500μL of 5M NaCl solution;

[0033]...

Embodiment 2

[0039] A rapid detection method for E. coli PCR amplification products, the specific steps are as follows:

[0040] (1) Extraction of E. coli DNA template by magnetic bead method

[0041] A. Take 1mL of Escherichia coli bacteria liquid, centrifuge at 10000r / min for 5min, remove the supernatant, dissolve the precipitate in 1mL of bacterial lysate, shake for 15s, 70℃ water bath for 12min, centrifuge at 5000r / min to obtain 1mL of cell lysate; where the bacteria are lysed The formulation of the solution is 50μL of 1M Tris-HCl, 50μL of 15wt% SDS solution, 50μL of 20mg / ml proteinase K, 20μL of 0.5M EDTA with pH=5.0, 2μL of RNase, and make up to 1mL with double distilled water;

[0042] B. Add 10 μL of magnetic nanoparticles to 1 mL of cell lysate, vortex for 5 seconds, then add 600 μL of adsorption buffer to mix, shake for 15 minutes, and magnetically separate the supernatant; the adsorption buffer consists of 80 μL of 9wt% polyethylene glycol Mixing 20000 solution and 500μL of 5M NaCl ...

Embodiment 3

[0049] The difference is that the food pathogen to be tested is Campylobacter jejuni, the 5'end of the Campylobacter jejuni forward primer is linked to the horseradish peroxidase complementary sequence, and the gene sequence is AAAAAATTTACCCAACCCGCCCTACCCAAAAAATTTACCCAACCCGCCCTACCCAAAAA-5'- AGCAGGGATAAGCCCTCTTG-3'; the gene sequence of the reverse primer of Campylobacter jejuni is 5'-AGCGATCTATTTGCCATCG-3'.

[0050] The DNA agarose gel electrophoresis diagram of the Campylobacter jejuni DNA template extracted by the magnetic bead method is as follows Picture 9 As shown in the figure, M, 1, 2, 3, 4, and 5 respectively represent DNA fragments with different molecular weights, and 1.3*10 is extracted 5 , 1.2*10 6 , 1.0*10 7 , 4.1*10 7 , 8.2*10 7 Electrophoretic band of cfu / mL Campylobacter jejuni DNA.

[0051] Picture 10 It is the agarose gel electrophoresis diagram of different concentrations of Campylobacter jejuni DNA template after PCR amplification reaction. M, 1, 2, 3, 4, 5 rep...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fast detection method of PCR amplification products of food pathogenic bacteria. The method is characterized including the following steps that after 50 microns of a hemin solution is added into the to-be-detected PCR amplification products of the food pathogenic bacteria, TMB color developing liquid is added after a reaction is performed for 10 min at 37 DEG C, incubation is performed for 5-10 min at room temperature till the color of the solution becomes blue, after termination is performed through a 0.16 M H2SO4 solution, whether the food pathogenic bacteria are contained in the to-be-detected samples or not is determined through color changes, the 5' end of a to-be-detected food pathogenic bacteria PCR amplification forward primer or backward primer is connected with a horseradish peroxidase complementary sequence, the gene sequence is AAAAAATTTACCCAACCCGCCCTACCCAAAAAATTTACCCAACCCGCCCTACCC AAAAA, and the method has the advantages that detection speed is high, and sensitivity and specificity are high.

Description

Technical field [0001] The invention relates to the detection of pathogenic bacteria, in particular to a rapid detection method of PCR amplified products of pathogenic bacteria. Background technique [0002] Food is the fundamental basis for human existence. Food safety is related to the health and life safety of the people. Frequent food safety incidents not only pose a serious threat to the health of the people, but also give consumers and food-related issues. The industry has caused huge economic losses and adversely affected the social, economic, and political stability and national image. Sensitive and efficient food safety detection technology plays a vital role in ensuring food safety, especially the control of foodborne diseases caused by pathogenic bacteria. According to the statistics of the Bureau of Economic Research of the United States Department of Agriculture, Salmonella, pathogenic large intestine Bacillus, Campylobacter, Vibrio parahaemolyticus, Staphylococcus ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/10C12Q1/04
CPCC12Q1/686C12Q1/6806C12Q2563/125C12Q2563/143C12Q2563/155
Inventor潘道东程克文陈伟吴振孙杨赢曹锦轩曾小群
OwnerNINGBO UNIV