CRISPR-Cas9 system and application therefore in treating breast cancer diseases

A breast cancer and multipurpose technology, applied in the field of genetic engineering, can solve the problems affecting the specific knockout of the target gene, wrong targeting, etc., and achieve the effect of wide applicability, low cost and simple operation

Active Publication Date: 2016-12-07
广东龄值生物科技有限公司
View PDF2 Cites 31 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, whether the sgRNA can specifically and accurately target the target gene is a prerequisite for whether CRISPR-Cas9 can specifically knock out the target gene. Whether it is off-target or wrongly targeted, it will affect the specificity of CRISPR-Cas9 to the target gene. knockout

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR-Cas9 system and application therefore in treating breast cancer diseases
  • CRISPR-Cas9 system and application therefore in treating breast cancer diseases
  • CRISPR-Cas9 system and application therefore in treating breast cancer diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] The design of embodiment 1sgRNA

[0059] First, select the 5'-GGN(19)GG sequence based on the RecQL4 gene shown in SEQ ID NO: 1. If there is no 5'-GGN(19)GG sequence, 5'-GN(20)GG or 5'- N(21)GG also works. The targeting site of the sgRNA on the STAT6 gene is located in the exon of the gene. Use BLAT in the UCSC database or BLAST in the NCBI database to determine whether the target sequence of the sgRNA is unique. At the same time, according to the design rules of other sgRNAs, a total of 57 sgRNAs were designed. However, the final experiment confirmed that only 17 of them have the function of targeted modification. Here, the sequences without functions are not listed one by one, only given Two counter-examples, which also fully demonstrate that in the prior art, the design of sgRNA cannot obtain functional sgRNA only according to the design rules without experiments. The sgRNA sequence involved in the present invention is as follows:

[0060] RecQL4-sg1: gcaagcgcggag...

Embodiment 2

[0079] Embodiment 2, construct the oligonucleotide duplex of sgRNA

[0080] According to the selected sgRNA: RecQL4-sg1, add CCGG to its 5' to get the forward oligonucleotide

[0081] (Forward oligo) (if the sequence itself already has 1 or 2 Gs at the 5' end, then correspondingly omit 1 or 2 Gs); according to the selected sgRNA, obtain the complementary strand of its corresponding DNA, and at its 5' AAAC was added to obtain a reverse oligonucleotide (Reverse oligo). Synthesize the above-mentioned forward oligonucleotide and reverse oligonucleotide respectively, and the designed forward oligonucleotide (Forward oligo) is:

[0082] ccggcaagcgcggaggccgggcgggcg (SEQ ID NO: 21); the reverse oligonucleotide (Reverse oligo) is aaacgcccgcccggcctccgcgcttgc (SEQ ID NO: 22).

[0083] The forward oligo and reverse oligo of the synthesized sgRNA oligonucleotide are denatured and annealed in pairs, and after annealing, a double strand that can be connected to the U6 eukaryotic expression...

Embodiment 3

[0086] Embodiment 3, the construction of sgRNA oligonucleotide plasmid

[0087] 1. Linearize the pGL3-U6-sgRNA plasmid. Enzyme digestion system and conditions are as follows: 2 μg pGL3-U6-sgRNA (400ng / μl); 1 μl CutSmart Buffer; 1 μl BsaI (NEB, R0535L); replenish water to 50 μl, incubate at 37 degrees for 3-4 hours, shake and centrifuge at intervals To prevent droplets from evaporating onto the tube cap.

[0088] 2. Ligate the annealed sgRNA oligonucleotide double strands to the linearized pGL3-U6-sgRNA plasmid to obtain the pGL3-U6-RecQL4-sg1 plasmid.

[0089] 3. Transform and coat Amp+ plates (50 micrograms / ml).

[0090] 4. identify positive clones with the method of universal primer U6 sequencing, the primers are

[0091] atggactatcatatgcttaccgta.

[0092] 5. Shake the bacteria overnight on a 37-degree shaker and extract the pGL3-U6-RecQL4-sg1 plasmid with a plasmid extraction kit.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a CRISPR-Cas9 system and an application thereof in treating breast cancer diseases, wherein by providing a plurality of sgRNAs (single guide RNAs), the efficient knockout of an RecQL4 gene can be achieved. In comparison with ZFNs and TALENs complex expression structures, siRNA is low in using complexity and efficiency; a Cas9 expression structure in the CRISPR-Cas9 system is fixed; for different genes, system building can be completed by interpolating recognition sequences into the sgRNA expression structure, so that operations are simplified and cost is reduced; and the system is applicable to mammal gene targeting in a large scale.

Description

technical field [0001] The present invention relates to the field of genetic engineering, and more specifically relates to a CRISPR-Cas9 method for specifically knocking out the human RecQL4 gene and a sgRNA for specifically targeting the RecQL4 gene. Background technique [0002] Breast cancer is the most common cancer in women and mainly includes ductal and lobular carcinomas. In 2011, the latest statistics released by CA (A Cancer Journal Clinicians) in the United States showed that in the United States in 2011, 230,480 women were expected to suffer from breast cancer, accounting for 30% of new malignant tumors in women, ranking first in the incidence of female malignant tumors. , and the death toll will reach 39,520. What's more serious is that the global incidence of breast cancer is increasing year by year. The diagnostic methods of breast cancer mainly include mammography, breast color Doppler ultrasonography, mammary duct endoscopy, mammary duct lavage, CT and magn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/113C12N15/85A61K31/7088A61P35/00
CPCA61K31/7088C07K14/47C12N15/113C12N15/85C12N2310/10C12N2800/107C12N2800/80
Inventor李蒙
Owner广东龄值生物科技有限公司