Optically controlled gene expression device for highly-efficiently regulating tumor cell phenotype
A gene expression and tumor cell technology, applied in the field of gene regulation, can solve problems such as low transcriptional regulation efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0018] The present invention will be further described in detail below through specific embodiments in conjunction with the accompanying drawings. It should be understood that the embodiments are only exemplary and not intended to limit the protection scope of the present invention.
[0019] I. Technology and method
[0020] 1. Plasmid construction
[0021] Gene anchoring components (CIBN-dCas9, dCas9-CIBN, CIBN-dCas9-CIBN and dCas9-trCIB1), transcription activation components (CRY2-VP64FL and CRY2PHR-P65), Tet promoter targeting sgRNA (target sequence: CTCCCTATCAGTGATAGAGA, SEQ ID NO: 1) and mCherry reporter gene carrier (Tet-Cherry) were purchased from Addgene ( http: / / www.addgene.org / ), see Table 1. The synthetic wild-type p53 gene (GenBank NO: DQ263704.1) was double digested with EcoRI and BglII to replace the mcherry gene in the Tet-mcherry vector to construct a Tet-P53 effector gene vector.
[0022] Table 1 Addgene plasmids
[0023]
[0024] 2. Cell Culture
...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com