Unlock instant, AI-driven research and patent intelligence for your innovation.

Optically controlled gene expression device for highly-efficiently regulating tumor cell phenotype

A gene expression and tumor cell technology, applied in the field of gene regulation, can solve problems such as low transcriptional regulation efficiency

Active Publication Date: 2017-02-08
THE SECOND PEOPLES HOSPITAL OF SHENZHEN
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to overcome the problem of low transcriptional regulation efficiency, the present invention describes a high-efficiency light-controlled gene expression device based on the interaction between dCas9 and photosensitive CRY2-CIB1, and uses it to inhibit the proliferation of bladder cancer cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optically controlled gene expression device for highly-efficiently regulating tumor cell phenotype
  • Optically controlled gene expression device for highly-efficiently regulating tumor cell phenotype
  • Optically controlled gene expression device for highly-efficiently regulating tumor cell phenotype

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0018] The present invention will be further described in detail below through specific embodiments in conjunction with the accompanying drawings. It should be understood that the embodiments are only exemplary and not intended to limit the protection scope of the present invention.

[0019] I. Technology and method

[0020] 1. Plasmid construction

[0021] Gene anchoring components (CIBN-dCas9, dCas9-CIBN, CIBN-dCas9-CIBN and dCas9-trCIB1), transcription activation components (CRY2-VP64FL and CRY2PHR-P65), Tet promoter targeting sgRNA (target sequence: CTCCCTATCAGTGATAGAGA, SEQ ID NO: 1) and mCherry reporter gene carrier (Tet-Cherry) were purchased from Addgene ( http: / / www.addgene.org / ), see Table 1. The synthetic wild-type p53 gene (GenBank NO: DQ263704.1) was double digested with EcoRI and BglII to replace the mcherry gene in the Tet-mcherry vector to construct a Tet-P53 effector gene vector.

[0022] Table 1 Addgene plasmids

[0023]

[0024] 2. Cell Culture

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an optically controlled gene expression device for highly-efficiently regulating tumor cell phenotype. The optically controlled gene expression device comprises a gene anchoring assembly, a transcriptional activation assembly, an sgRNA vector and a report / effect gene vector, wherein the gene anchoring assembly comprises a CIBN-dCas9-CIBN expression sequence represented by SEQ ID NO:4, the transcriptional activation comprises a CRY2PHR-P65 expression sequence represented by SEQ ID NO:7, the protein of the gene anchoring assembly is combined with a target sequence under the guidance of the sgRNA, and the CIBN-dCas9-CIBN is combined with the CRY2PHR-P65 under the irritation of blue lights to activate expression of report / effect gene. The optically controlled gene expression device can effectively drive expression of the report / effect gene in bladder cancer cells.

Description

technical field [0001] The invention relates to the technical field of gene regulation, in particular to a light-controlled gene expression device and a method for efficiently regulating the phenotype of tumor cells. Background technique [0002] Gene expression systems regulated by chemical small molecules have been widely used in biomedicine and biotechnology research [1,2]. However, chemical molecules are easy to diffuse freely and difficult to remove, which limits their further applications, especially when high-precision spatiotemporal control is required. Light can be regulated with high precision in spatiotemporal resolution, so it is an ideal inducer of gene expression [3-6]. Therefore, the development of light-induced gene expression devices is very necessary and has attracted extensive attention [7]. Undoubtedly, the use of light to regulate biological production processes and biomedical interventions will be a very exciting development. [0003] At present, the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/65
CPCC12N15/65C12N15/85C12N2800/107C12N2800/80C12N2810/10
Inventor 黄卫人蔡志明林帆
Owner THE SECOND PEOPLES HOSPITAL OF SHENZHEN