Method for improving efficiency of CRISPR mediated homologous recombination

A homologous recombination and high-efficiency technology, applied in the field of gene editing, can solve problems such as low efficiency and limiting the application of gene editing technology

Inactive Publication Date: 2017-02-15
SHENZHEN WEIGUANG BIOLOGICAL PROD
View PDF2 Cites 45 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, HR only occurs in a specific period of cell division, and the efficiency is low, which greatly limits the application of HR-based gene editing technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving efficiency of CRISPR mediated homologous recombination
  • Method for improving efficiency of CRISPR mediated homologous recombination
  • Method for improving efficiency of CRISPR mediated homologous recombination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Example 1—shNHEJ TLR1.1 sgRNA vector construction and detection of HR-mediated efficiency

[0016] The shNHEJ TLR1.1 sgRNA vector construction strategy is as follows: figure 1 As shown, the details are as follows:

[0017] shNHEJ sgRNA vector design;

[0018] According to the mRNA sequences of human Lig4, DNA-PK and XRCC6, shRNA target sites with a length between 20-24nt were designed respectively. The sense chain in the shRNA is completely consistent with the sequence of the target gene mRNA, and the sequence of the antisense can be completely complementary to the sense. Antisense is best to perform blast to ensure that it does not have too many base pairs with other mRNAs in the genome-wide mRNA, so as to avoid off-target effects. The loop area between sense and antisense can be freely designed as an unpaired area, but the processing efficiency of UGUG motifs in the loop area is better. The design of sgRNA needs to consider the corresponding PAM site on the target...

Embodiment 2

[0032] Example 2—shNHEJ AAVS1 sgRNA vector construction

[0033] The expression of recombinant protein drugs requires the construction of stable and high-expression cell lines. It is known that the expression efficiency of genes integrated into certain sites of the human genome is relatively high and relatively stable, and it is not easy to be deleted or silenced in the process of multiple passages of cells. Therefore, The specific integration of exogenous genes into these sites helps to improve the construction efficiency of cell lines with stable and high expression of recombinant proteins. Among them, at the AAVS1 site, we intend to use our strategy to achieve this efficient site-specific integration. details as follows:

[0034] Design of sgRNA targeting AAVS1 locus: GGGGCCACTAGGGACAGGATGTTTTGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT

[0035] AAVS1 sgRNA is replaced TLR1.1sgRNA in pcDNA3.1(-)shNHEJ TLR1.1 sgRNA in embodiment 1 ( Figure 4 ) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the efficiency of CRISPR mediated homologous recombination. The method includes the steps of: inhibiting the expression of Lig4, DNA-PK and XRCC6 by shRNA so as to inhibit the non-homologous end joining (NHEJ) repair pathway; conducting fusion expression on sgRNA and shRNA at targeting genome specific positions to form shRNA-sgRNA polycistron; and placing the polycistron at the RNA polymerase II or RNA polymerase III promoter downstream. The carrier constructed by the method provided by the invention has a concise structure and is convenient to use, also enhances the homologous recombination efficiency by dozens of times, greatly expands the function and application of the CRISPR carrier, and is a good tool for functional gene and signal pathway research, medical research, and recombinant protein expression.

Description

technical field [0001] The invention relates to the technical field of gene editing, in particular to a method for improving the efficiency of homologous recombination mediated by CRISPR. Background technique [0002] Genome editing is a technology that can precisely modify the genome of an organism. Using genome editing technology, specific genes in cells can be mutated, knocked in, and deleted, thereby changing the genetic characteristics of the organism. The current genome editing technology uses certain methods to cause DNA damage at specific positions in the genome, thereby stimulating the DNA damage repair mechanism in cells. There are two main mechanisms for repairing DNA double-strand breaks in cells: one is non-homologous end joining Pathway (full name in English: Non-homologous End Joining, English abbreviation: NHEJ), in this pathway, cells perform partial enzyme digestion on DNA breaks to produce sticky ends, and then connect the two ends. Some bases are lost, s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85
CPCC12N15/85C12N2800/40C12N2810/10C12N2840/20
Inventor谢晨梁富冀倩倩
OwnerSHENZHEN WEIGUANG BIOLOGICAL PROD