Method for improving efficiency of CRISPR mediated homologous recombination
A homologous recombination and high-efficiency technology, applied in the field of gene editing, can solve problems such as low efficiency and limiting the application of gene editing technology
Image
Examples
Embodiment 1
[0015] Example 1—shNHEJ TLR1.1 sgRNA vector construction and detection of HR-mediated efficiency
[0016] The shNHEJ TLR1.1 sgRNA vector construction strategy is as follows: figure 1 As shown, the details are as follows:
[0017] shNHEJ sgRNA vector design;
[0018] According to the mRNA sequences of human Lig4, DNA-PK and XRCC6, shRNA target sites with a length between 20-24nt were designed respectively. The sense chain in the shRNA is completely consistent with the sequence of the target gene mRNA, and the sequence of the antisense can be completely complementary to the sense. Antisense is best to perform blast to ensure that it does not have too many base pairs with other mRNAs in the genome-wide mRNA, so as to avoid off-target effects. The loop area between sense and antisense can be freely designed as an unpaired area, but the processing efficiency of UGUG motifs in the loop area is better. The design of sgRNA needs to consider the corresponding PAM site on the target...
Embodiment 2
[0032] Example 2—shNHEJ AAVS1 sgRNA vector construction
[0033] The expression of recombinant protein drugs requires the construction of stable and high-expression cell lines. It is known that the expression efficiency of genes integrated into certain sites of the human genome is relatively high and relatively stable, and it is not easy to be deleted or silenced in the process of multiple passages of cells. Therefore, The specific integration of exogenous genes into these sites helps to improve the construction efficiency of cell lines with stable and high expression of recombinant proteins. Among them, at the AAVS1 site, we intend to use our strategy to achieve this efficient site-specific integration. details as follows:
[0034] Design of sgRNA targeting AAVS1 locus: GGGGCCACTAGGGACAGGATGTTTTGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT
[0035] AAVS1 sgRNA is replaced TLR1.1sgRNA in pcDNA3.1(-)shNHEJ TLR1.1 sgRNA in embodiment 1 ( Figure 4 ) ...
PUM
Login to View More Abstract
Description
Claims
Application Information
- IPC
- C12N15/85
- CPC
- C12N15/85; C12N2800/40; C12N2810/10; C12N2840/20
- Inventors
- 谢晨; 梁富



