Kit for PRRSV (porcine reproductive and respiratory syndrome virus) serology differential diagnosis
A technique for differential diagnosis of respiratory syndrome, applied in the field of porcine reproductive and respiratory syndrome virus (PRRSV) serological differential diagnosis kit, can solve problems such as not seen
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Select the conserved antigenic epitopes for the N protein of American and European PRRSV ( 50 PEKPHFPLATED DVRHHFTPS 70 ) and the conserved epitope against GP5 ( 195 TRVSAEQWGRL 200 ), the selected epitope ( 50 PEKPHFPLATED DVRHHFTPS 70 with 195 TRVSAEQWGRL 200) nucleotide sequences were concatenated and optimized according to the requirements of prokaryotic expression conditions. The optimized sequence was GGATCCCCGGAGAAGCCGCATTTCCCGCTGGCGACTGAAGATGACGTCCGTCATCACTTTACCCCCGAGTACCCGTGTTTCAGCGGAACAATGGGGTCGTCCTCTGAGCGGCCGC; at the ends (5' and 3') of the optimized sequence were introduced BamHI (GGATCC) and NotI (GCGGCCGC) restriction site (sequence in the box), and a stop codon TGA is introduced before the 3-terminal restriction site. After gene synthesis, the optimized sequence was cloned into the prokaryotic expression vector pET32a. The positive recombinant plasmid pET32a-N-GP5-e was constructed according to the conventional prokaryotic expression method. Afte...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


