A serological differential diagnosis kit for porcine reproductive and respiratory syndrome virus
A technique for differential diagnosis of respiratory syndrome, applied in the field of porcine reproductive and respiratory syndrome virus (PRRSV) serological differential diagnosis kit, can solve problems such as not seen
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] 1. Both American and European PRRSV serological antibodies can be detected ELISA kit
[0027] 1. Selection, tandem expression and identification of antigenic epitopes
[0028] Select the conserved antigenic epitopes for the N protein of American and European PRRSV ( 50 PEKPHFPLATED DVRHHFTPS 70 ) and the conserved epitope against GP5 ( 195 TRVSAEQWGRL 200 ), the selected epitope ( 50 PEKPHFPLATED DVRHHFTPS 70 and 195 TRVSAEQWGRL 200) nucleotide sequences were concatenated and optimized according to the requirements of prokaryotic expression conditions. The optimized sequence was GGATCCCCGGAGAAGCCGCATTTCCCGCTGGCGACTGAAGATGACGTCCGTCATCACTTTACCCCCGAGTACCCGTGTTTCAGCGGAACAATGGGGTCGTCCTCTGAGCGGCCGC; at the ends (5' and 3') of the optimized sequence were introduced BamHI (GGATCC) and NotI (GCGGCCGC) restriction site (sequence in the box), and a stop codon TGA is introduced before the 3-terminal restriction site. After gene synthesis, the optimized sequence was cloned i...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap