Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer and method for rapidly distinguishing larimichthys polyactis and larimichthys crocea and determining hybrid variety of larimichthys polyactis and larimichthys crocea

A technology of large yellow croaker and small yellow croaker, applied in biochemical equipment and methods, microbiological measurement/inspection, DNA/RNA fragments, etc., can solve the problems of inability to identify hybrids and small yellow croakers, morphological identification is not necessarily accurate, easy to be confused, etc. problem, to achieve the effect of quick identification method

Active Publication Date: 2017-05-24
MARINE FISHERIES RES INST OF ZHEJIANG
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, morphological identification is sometimes not necessarily accurate, and there are strong subjective factors, and morphological identification can only distinguish large yellow croakers from small yellow croakers and hybrid fish at the seedling stage, but cannot identify hybrids from small yellow croakers, because the latter two are in the seedling stage. Similar in shape, it is easy to confuse

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and method for rapidly distinguishing larimichthys polyactis and larimichthys crocea and determining hybrid variety of larimichthys polyactis and larimichthys crocea

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0016] (1) Select small yellow croaker, large yellow croaker and hybrid fish [small yellow croaker (♀) and large yellow croaker (♂)] for professional morphological identification;

[0017] (2) Extract the DNA of small yellow croaker, large yellow croaker and hybrid fish samples by phenol-chloroform extraction method;

[0018] (3) The PCR amplification reaction system is: 10×Buffer 2.5 μl, dNTP 2.0 μl, Taq enzyme 0.2 μl, upstream primer and downstream primer 1 μl, DNA template 1 μl, ddH2O 18.3 μl; PCR amplification reaction conditions are: 94°C After pre-denaturation for 5 minutes, enter 35 cycles: 94°C for 35sec, 59°C for 35sec, 72°C for 1.0min; finally, extend at 72°C for 10min;

[0019] Upstream primer: 5'- GGTGGTGGCAAAATTTGATT -3' (as shown in SEQ ID No.1);

[0020] Downstream primer: 5'-CCACACACCTAATGCCTCCT-3' (as shown in SEQ ID No.2);

[0021] (3) Electrophoresis staining comparison pattern: After the PCR reaction, 8 μL of the product was detected by agarose gel electr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a primer and a method for rapidly distinguishing larimichthys polyactis and larimichthys crocea and determining a hybrid variety of the larimichthys polyactis and the larimichthys crocea, which belong to the field of identification of molecular markers. A nucleotide sequence of an upstream primer of the primer is shown as SEQ ID No. 1, and a nucleotide sequence of a downstream primer is shown as SEQ ID No. 2. By adopting the primer and the method, complex steps such as sequence measurement are not needed, after the appropriate PCR proliferation, a hybrid filial generation can be accurately determined as the hybrid variety, and the larimichthys polyactis and hybrid fish can be distinguished, so that a novel simple and rapid identification method is provided for identifying the germplasm of three types of fish with similar appearance.

Description

technical field [0001] The invention belongs to the field of molecular marker identification, in particular to a primer and a method for rapidly distinguishing small yellow croaker from large yellow croaker and judging hybrids of small yellow croaker and large yellow croaker. Background technique [0002] Both small yellow croaker and large yellow croaker belong to the four major marine products. Their meat is tender and delicious, and are favored by consumers. However, due to overfishing, environmental changes and other reasons, small yellow croakers are precocious and miniaturized. The wild resources of large yellow croakers are extremely scarce, and the quality of their breeding populations has seriously declined, and the economic benefits have decreased significantly. Hybridization can transfer the genetic material of organisms from one population to another, and is an important method to increase the variability of organisms. The recombination of variable traits can be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q1/6888C12Q2600/156C12Q2531/113C12Q2565/125
Inventor 刘峰楼宝陈睿毅徐冬冬詹炜王立改
Owner MARINE FISHERIES RES INST OF ZHEJIANG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More