Visual cell repair efficiency reporting system based on artificial nuclease and establishing method of system
A technology for reporting systems and repairing efficiency, applied in biochemical equipment and methods, nucleic acid vectors, and the use of vectors to introduce foreign genetic material, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0039] In order to make the technical solution of the present invention easy to understand, the following uses yeast-derived Rad52 protein (abbreviated as ScRad52) and CRISPR-Cas9 to edit human VEGFA gene, and detects the embodiment of ScRad52 improving the efficiency of HR after CRISPR-Cas9 targeting, for the present invention For further details.
[0040] 1. Target site selection
[0041] Based on the characteristics of the target sites of the CRISPR / Cas9 system, the target sites containing PAM (NGG / NGGNG) were searched in the genome. After screening on the CRISPR Dsign website (http: / / crispr.mit.edu / ), the following site was selected as the VEGFA target site (VEGFA target): CTCGGCCACCACAGGGAAGC (see SEQ.ID.NO.1, 5 from the left `end)
[0042] 2. Construction of CRISPR / Cas9 expression vector (pLL3.7-U6-VEGFA.sgRNA-CBh-SpCas9)
[0043] The CRISPR / Cas9 expression vector was transformed and constructed in our laboratory, that is, the sequence of the sgRNA capable of expressi...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap