A detection method for sea cucumber pathogenic bacteria Shewanella flavina

A technology of Shewanella and a detection method is applied in the detection field of Shewanella yellow sea cucumber pathogenic bacteria, which can solve the problems affecting the accuracy of detection results, poor system stability, easy to produce deviation, etc., and achieves rapid and efficient detection, The effect of improving capacity, preventing occurrence and spread

Inactive Publication Date: 2020-11-06
DALIAN OCEAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Bacteria detection gene chips mostly use bacteriologically conservative genes, such as the "living fossil" 16S rRNA gene known as bacterial evolution, and the 16S rRNA gene has less information sites, so the stability of the constructed system is poor. Used to identify bacteria with close kinship, it is easy to produce deviations, cause false positives, and affect the accuracy of test results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A detection method for sea cucumber pathogenic bacteria Shewanella flavina
  • A detection method for sea cucumber pathogenic bacteria Shewanella flavina
  • A detection method for sea cucumber pathogenic bacteria Shewanella flavina

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Design and synthesis of embodiment 1 probe

[0032] 1. Target detection strains and target genes

[0033] The present invention selects an important common pathogenic bacterium Shewanella yellowsea in the sea cucumber breeding area environment and organisms as the detection object, and uses DNAgyrase subunit B as the target gene;

[0034] 2. Probe design

[0035] The present invention uses 18-30bp oligonucleotide probes. The basic requirement of probe parameters is specific and efficient hybridization, and the following conditions should be met: ①The Tm value of the probe should remain similar and fluctuate within a range of 10°C; ②The number of consecutive complementary bases that form dimers and hairpin structures Less than 4; ③ The number of consecutive matching bases between the probe and the non-target gene sequence is less than 7 bases; ④ The number of mismatched bases between the probe and the target gene is less than 4 bases.

[0036] The present invention de...

Embodiment 2

[0043] The making of embodiment 2 gene chip

[0044] Utilize the probe designed in Example 1 to prepare the important common pathogenic bacteria Shewanella flavumii used in the sea cucumber culture area environment and organisms, the specific steps are as follows:

[0045] 1. Preparation of probe mother solution

[0046] Dilute the synthesized probe (Table 2) into a 100 μmol / L mother solution with double distilled water, and then dilute it to a concentration of 20 μmol / L with a spotting buffer;

[0047] 2. Preparation before sampling

[0048] Transfer 100 μL to wells A1, B1 and C1 of a 96-well plate, and add 100 μL of spotting buffer to well D1;

[0049] 3. Spotting

[0050] Use the AD1500 gene chip spotting instrument of Bio-Dot Company of the United States to carry out non-contact spotting on the aldehyde substrate according to the pre-set program; the spotting volume of each point is 0.5 μL, the spot diameter is 200 μm, and the point spacing is 1.5 μL. mm, the relative ...

Embodiment 3

[0056] The method for using the gene chip (prepared in Example 2) for detecting the important common pathogenic bacteria Shewanella yellowsea in the sea cucumber breeding area environment and organisms, the specific steps are as follows:

[0057] 1. Collection and processing of samples to be tested

[0058] Use an 8 μm sterile filter membrane to remove impurities from the obtained water sample, then filter it with a 0.22 μm filter membrane and collect the filter membrane, wrap it in sterile aluminum foil, and store it at -20°C;

[0059] The mud sample is taken from 100g of sediment at the bottom 2-5cm of the breeding environment, and the collected samples are transported to the laboratory in an ice box;

[0060] Animal samples were cut with sterile scissors, rinsed with sterile water three times, put into cryopreservation tubes, and stored in liquid nitrogen.

[0061] 2. Template DNA preparation

[0062] DNA from water samples and mud samples was extracted with OMEGA Water D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting a sea cucumber pathogenic bacterium, namely shewanella smarisflavi. The sequences of a probe SM1 and a probe SM2 for detection are as follows: SM1(5'-3'): CTTCTCGGATGTCGAGTTCCACTTCGA; and SM2(5'-3'): TCTGAAAAGCTACAGTTAACCATTCGTCGT. The method comprises the following steps: modifying the probes with amino, preparing gene chips, extracting DNA (Deoxyribonucleic Acid) of a sample to be detected, performing PCR (Polymerase Chain Reaction) amplification, performing fluorescence labeling, hybridizing with the gene chips, and detecting results by using a scanner. The method has the advantages that the sea cucumber pathogenic bacterium, namely shewanella smarisflavi can be rapidly and effectively detected, characteristics of being relatively good in specificity and sensitivity can be achieved, the capability of evaluating environments of sea cucumber cultivation areas and detecting the living body pathogenic bacterium, namely shewanella smarisflavi, the detection time can be greatly shortened, and occurrence and spreading of 'skin fester' can be effectively prevented.

Description

technical field [0001] The invention relates to a detection method for sea cucumber pathogenic bacteria Shewanella yellowsea. Background technique [0002] Sea cucumber is a species with the largest output value in mariculture in the northern coastal areas of my country. In recent years, with the rapid expansion of the breeding scale and the irregular operation in the production process, the diseases of the cultured sea cucumbers have occurred seriously, causing huge economic losses. Among them, "sick skin disease" is the most serious disease currently prevalent, and the disease is mainly caused by bacterial infection. Shewanella yellow sea is an important pathogen that causes the sea cucumber's chemical skin disease in the northern region. [0003] At present, the detection method of marine microorganisms is generally a biochemical detection method, but this method has the disadvantages of long cultivation period, cumbersome operation, and poor specificity. At the same ti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/689C12Q1/6816C12Q1/04C12R1/01
CPCC12Q1/6816C12Q1/689C12Q2531/113C12Q2563/107
Inventor王荦丁君常亚青
OwnerDALIAN OCEAN UNIV