How to Identify Cherry Varieties
A technology of variety identification and identification method, applied in the field of molecular identification of cherry varieties, can solve problems such as confusion, loss of cherry industry, difficulties in breeding of sweet cherry varieties and protection of property rights, etc., and achieve the effect of reducing experimental costs and accurate detection results
Active Publication Date: 2020-12-01
ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
View PDF4 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
However, at present, most of the varieties widely cultivated in various cultivation areas in China are imported from abroad. With the gradual increase in the number of sweet cherry varieties and the frequent exchange of germplasm, as well as the established pattern of multi-plant breeding and multi-management, different species with the same name or different The name phenomenon is very common, which not only brings many difficulties and confusion to sweet cherry variety breeding and property rights protection, but also causes serious losses to the cherry industry.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0038] Example 1 Establishment of cherry variety identification method based on S genotype information and SSR core primer combination
[0039] 1. Materials and methods
[0040] 1.1 Materials
[0041] A total of 87 sweet cherry varieties were tested, all of which were obtained from the Cherry Germplasm Resource Garden of Zhengzhou Institute of Pomology, Chinese Academy of Agricultural Sciences.
[0042] 1.2 Method
[0043] 1.2.1 DNA extraction and primer synthesis
[0044] In spring, young shoots and leaves were taken, and the genomic DNA of the leaves was extracted by CTAB method, and then stored in a -20°C refrigerator. Referring to the previous literature, 48 pairs of SSR primers (Table 1) that were evenly distributed on the 8 chromosomes of sweet cherry were selected to amplify 1 pair of S allele primers (Pru-T2 (GTTCTTGCTTTTGCTTTCTTC) and SI 32 (CATAGGCCATGGATGGTG). The 12 varieties of the 12 varieties were amplified, and the 11 pairs of primers with higher polymorphi...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
The invention discloses a method for identifying a cherry variety, and belongs to the field of molecule identification of cherry varieties. The invention firstly discloses 11 pairs of SSR (Simple Sequence Repeats) primers for identifying the varieties of cherry, wherein the nucleotide sequences of the primers are as shown in SEQ ID No.1 to SEQ ID No.22. By adopting the method, core primer combinations are further screened from the 11 pairs of the SSR primers, 87 cherry germplasms can be distinguished by using 5 core primer combinations, and the obtained primer combinations have the advantages of being high in polymorphism, high in amplification stability, good in repeatability, clear in electrophoretic band and the like. The invention further discloses a cherry variety identification method and a kit based on S genotype information and SSR primer combinations. By adopting the primers, identification upon different cherry varieties can be rapidly and accurately completed. The SSR primer pairs, the cherry variety identification method and the kit disclosed by the invention can be applied to cherry germplasm evaluation, cherry germplasm innovation, parent choice for breeding, and the like.
Description
technical field [0001] The invention relates to a cherry variety identification method, in particular to a cherry variety identification method based on the combination of S genotype information and SSR core primers, and belongs to the field of molecular identification of cherry varieties. Background technique [0002] Over the past 20 years, China's sweet cherry industry has rapidly expanded from traditionally planted Shandong and Liaoning to Henan, Shanxi, Shaanxi, Gansu, Jiangsu and other provinces along the Longhai Railway, as well as cold highlands such as Yunnan, Guizhou and Sichuan. As of the spring of 2016, the cultivated area of sweet cherry in China has reached 153,300 ha 2 . However, at present, most of the varieties widely cultivated in various cultivation areas in China are introduced from abroad. With the gradual increase in the number of sweet cherry varieties and the frequent exchange of germplasm, as well as the established pattern of multi-plant breeding...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156
Inventor 刘聪利李明齐希梁李玉红邱新强丁金鸽
Owner ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI