GRA17 gene deleted toxoplasma gondii attenuative mutant strain and preparation method thereof
A gene deletion and Toxoplasma gondii technology, applied in the field of Toxoplasma gondii attenuated mutant strains and its preparation, can solve the problem of limited application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] A Toxoplasma gondii attenuated mutant strain with GRA17 gene deletion. The toxoplasma gondii attenuated mutant strain with GRA17 gene deletion is LZ△GRA17, which is preserved in China Center for Type Culture Collection with the preservation number CCTCC NO: V201656.
[0038] The preparation method of the toxoplasma gondii attenuated mutant strain of above-mentioned GRA17 gene deletion, such as figure 1 shown, including the following steps:
[0039] 1. Construction of pSAG1::Cas9-U6::sg GRA17 plasmid:
[0040] 1. Use web software to design the sgRNA of GRA17 as GACTGTCCCTGAGGACCCAT.
[0041] 2. Use the Q5 site-directed mutagenesis kit (NEB) and amplification primers (gRNA-Fw: GACTGTCCCTGAGGACCCATG TTTTAGAGCTAGAAATAGC and gRNA-Rv: AACTTGACATCCCCATTTAC) to replace sgUPRT in pSAG1::Cas9-U6::sgUPRT vector with sgRNA of GRA17 to construct pSAG1: :Cas9-U6::sgGRA17.
[0042] 3. The PCR conditions are: using pSAG1::Cas9-U6::sgUPRT as a template, using primers gRNA-Fw and gRN...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



