Application of CRISPR/Cas 9 technology in obtaining of bombyx zinc finger protein gene mutation
A 1. CRISPR, zinc finger protein technology, applied in genetic engineering, recombinant DNA technology, stably introducing foreign DNA into chromosomes, etc., can solve the problem of no transcription factor gene research report
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] The silkworm zinc finger protein gene (gene number BG IBMGA014418-TA) was obtained from silkDB silkworm database, and the Nistari glutamic acid synthase gene sequence was obtained after designing primers to verify the gene sequence. Use the online software CRISPRdirect to design a 20bp sgRNA core sequence, screen out three target sites and synthesize the sequence cccAGATGCCTGACCCTAAGACT, cctGACCCTAAGACTTACAAACA or cctAAGAACGATCTACCAGATGA, respectively add the gaaattaatacgactcactata T7 promoter sequence in front, and the fragment gttttagagctagaaatagc complementary to crRNA / tracrRNA, artificially synthesized to 62bp The front primer, and the back primer crRNA / tracrRNA go through the PCR program to obtain the complete sgRNA sequence, see figure 1 .
[0028] The reagents used are listed in Table 1. The PCR reaction conditions are shown in Table 2.
[0029] Table 1 sgRNA synthesis system
[0030]
[0031]
[0032] Table 2 sgRNA synthesis PCR reaction temperature and...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


