Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of CRISPR/Cas 9 technology in obtaining of bombyx zinc finger protein gene mutation

A 1. CRISPR, zinc finger protein technology, applied in genetic engineering, recombinant DNA technology, stably introducing foreign DNA into chromosomes, etc., can solve the problem of no transcription factor gene research report

Inactive Publication Date: 2017-08-04
KUNMING UNIV OF SCI & TECH
View PDF3 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The CRISPR / Cas9 system has been successfully applied to gene editing of multiple genes in the silkworm, but no research on transcription factor genes has been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of CRISPR/Cas 9 technology in obtaining of bombyx zinc finger protein gene mutation
  • Application of CRISPR/Cas 9 technology in obtaining of bombyx zinc finger protein gene mutation
  • Application of CRISPR/Cas 9 technology in obtaining of bombyx zinc finger protein gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] The silkworm zinc finger protein gene (gene number BG IBMGA014418-TA) was obtained from silkDB silkworm database, and the Nistari glutamic acid synthase gene sequence was obtained after designing primers to verify the gene sequence. Use the online software CRISPRdirect to design a 20bp sgRNA core sequence, screen out three target sites and synthesize the sequence cccAGATGCCTGACCCTAAGACT, cctGACCCTAAGACTTACAAACA or cctAAGAACGATCTACCAGATGA, respectively add the gaaattaatacgactcactata T7 promoter sequence in front, and the fragment gttttagagctagaaatagc complementary to crRNA / tracrRNA, artificially synthesized to 62bp The front primer, and the back primer crRNA / tracrRNA go through the PCR program to obtain the complete sgRNA sequence, see figure 1 .

[0028] The reagents used are listed in Table 1. The PCR reaction conditions are shown in Table 2.

[0029] Table 1 sgRNA synthesis system

[0030]

[0031]

[0032] Table 2 sgRNA synthesis PCR reaction temperature and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of CRISPR / Cas 9 technology in obtaining of bombyx zinc finger protein gene mutation, and belongs to the technical field of bombyx breeding and gene engineering. In the invention, the CRISPR / Cas 9 gene editing technology is applied to obtain bombyx zinc finger protein gene mutation, a set of method for performing gene edition on zinc finger protein and exploring the gene function is realized, and thus a set of effective method for the batch research and transcription factors in future is provided.

Description

technical field [0001] The invention relates to the application of CRISPR / Cas9 technology in obtaining a mutant of the silkworm zinc finger protein gene, and belongs to the technical field of silkworm breeding and genetic engineering. Background technique [0002] The silkworm (Bombyx mori), a holometabolous Lepidoptera insect, is one of the most economically important insects at present. The invention of sericulture and silk reeling is an outstanding contribution made by the Chinese people to world civilization. Transcription factors are very important genes in silkworms. Many traits of silkworms are regulated by transcription factor family genes. Studying the functions of various transcription factors is of great significance for silkworm breeding and silk improvement and as a bioreactor for expressing foreign proteins. [0003] The rapid development of modern biotechnology, including transgenic technology and sequencing technology, has brought new development opportuniti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12N15/113
CPCC12N15/902C07K14/43586C12N15/113C12N2310/10
Inventor 朱亚楠王文相辉董扬
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com