Method for Producing L-Amino Acid of Glutamate Family

A manufacturing method, amino acid technology, applied in microorganism-based methods, biochemical equipment and methods, enzymes, etc., can solve problems such as unclear relationships, and achieve the effect of efficient manufacturing and improved production capacity

Active Publication Date: 2017-08-11
AJINOMOTO CO INC
View PDF81 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the relationship between α-KG uptake into vehicles and production of glutamate-like L-amino acids is unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for Producing L-Amino Acid of Glutamate Family
  • Method for Producing L-Amino Acid of Glutamate Family
  • Method for Producing L-Amino Acid of Glutamate Family

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0287] Hereinafter, although an Example demonstrates this invention more concretely, this invention is not limited to these examples.

[0288] Example: Glutamic acid production culture using kgtP gene expression enhanced strain

[0289] In this example, glutamic acid production was performed using a glutamic acid-producing strain of C. glutamicum into which the kgtP gene derived from Escherichia coli was introduced. The impact was evaluated. The kgtP gene is a gene encoding an α-ketoglutarate (α-KG) uptake carrier.

[0290] (1) Material

[0291] Materials used in this example are as follows.

[0292] Primers used in Table 1

[0293] Primer serial number Nucleotide sequence (5'→3') 1 1 ccaagcttgcatgcctgcagaggaggattataatggctgaaagtactgtaac 2 2 cggtacccggggatccctaaagacgcatcccccttcc 3 3 gaattcgagctcggtacccg 4 4 actggccgtcgttttacaac 5 5 aaaacgacggccagtacatcacaacagttcgctttg 6 6 accgagctcgaattcccgttttgaaaaagtatgttg 7 15 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A method for producing an L-amino acid of glutamate family such as L-glutamic acid is provided. An L-amino acid of glutamate family is produced by culturing a coryneform bacterium having an ability for producing an L-amino acid of glutamate family, which has been modified so that the activity of an alpha-ketoglutaric acid (alpha-KG) uptake carrier is increased, in a medium, and collecting the L-amino acid of glutamate family from the medium.

Description

technical field [0001] The present invention relates to a method for producing glutamic acid L-amino acids (L-amino acid of glutamate family) such as L-glutamic acid using coryneform bacteria. L-amino acid can be used industrially as a seasoning raw material and the like. Background technique [0002] L-amino acid is industrially produced by, for example, a fermentation method using microorganisms such as coryneform bacteria having L-amino acid production ability (Non-Patent Document 1). As such microorganisms, for example, strains isolated from nature and mutants thereof can be used. Moreover, the L-amino acid production capacity of microorganisms can be improved by recombinant DNA technology. For example, techniques for increasing the phosphoketolase activity (Patent Document 1) and utilizing a mutant yggB gene (Patent Document 2) are known as methods for improving the L-glutamic acid productivity of coryneform bacteria. [0003] The kgtP gene of Escherichia coli is a g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12P13/14C12N1/21C12R1/15
CPCC07K14/245C07K14/34C12N9/0008C12N9/001C12N9/1022C12P13/14C12Y102/04002C12Y103/99001C12Y202/01001C12P13/10C12P13/24C12Y401/02009
Inventor 平野圣子林和之高屋敷均福井启太
Owner AJINOMOTO CO INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap