Unlock instant, AI-driven research and patent intelligence for your innovation.

Pichia yeast recombinant bacteria for expressing Streptomyces sp. FA1 (fertilization antigen 1) source xylanase

A technology of Pichia pastoris and xylanase, which is applied in the field of genetic engineering, can solve problems such as the expression of episomal expression plasmids that have not yet been seen, and achieve the ability to improve the ability to secrete and produce xylanase, with low production costs and increased specific activity Effect

Active Publication Date: 2017-10-10
JIANGNAN UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in the expression system of Pichia pastoris, the xylanase gene is constructed into an integrated recombinant strain for recombinant expression of exogenous genes, and no episomal expression plasmid has been used for expression.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pichia yeast recombinant bacteria for expressing Streptomyces sp. FA1 (fertilization antigen 1) source xylanase
  • Pichia yeast recombinant bacteria for expressing Streptomyces sp. FA1 (fertilization antigen 1) source xylanase
  • Pichia yeast recombinant bacteria for expressing Streptomyces sp. FA1 (fertilization antigen 1) source xylanase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of expression vector pGAPZαA-PARS

[0035] The self-replicating sequence PARS whose nucleotide sequence is shown in SEQ ID NO. 2 was synthesized by the whole gene synthesis technology; the recovered PARS gene fragment was connected with the plasmid pGAPZαA by infusion enzyme, and the expression vector pGAPZαA-PARS was constructed.

Embodiment 2

[0036] Example 2: Construction of episomal pGAPZαA-PARS-XynA recombinant bacteria

[0037] Construction of recombinant plasmid pGAPZαA-PARS-XynA:

[0038] Using plasmid pMD18-T-XynA (A xylanase from Streptomyces sp.FA1: heterologousexpression, characterization, and its application in Chinese steamed bread, YangXu, Journal of Industrial Microbiology & Biotechnology, May 2016, Volume43, Issue5, pp 663-670) as a template, Design a forward primer whose sequence is shown in SEQ ID NO. 3: CCGGAATTCATGGCCGAGAACACCCTT, and a reverse primer whose sequence is shown in SEQ ID NO. 4: ATTTGCGGCCGCTCAGGTGCGGGTCCAGCGTT. The XynA fragment with Not I and EcoR I restriction sites was obtained by polymerase chain reaction.

[0039]PCR reaction system (50μL):

[0040]

[0041] PCR program: 94°C, 4min (pre-denaturation); 98°C, 10s (denaturation); 60°C, 5s (annealing); 72°C, 90s (extension); set 30 cycles; set after 72°C, 10min (insulation) The storage temperature is 4°C. The PCR product was...

Embodiment 3

[0049] Example 3: Construction of integrated pGAPZαA-XynA recombinant bacteria

[0050] Construction of recombinant plasmid pGAPZαA-XynA:

[0051] Using the plasmid pMD18-T-XynA as a template, design a forward primer with the sequence shown in SEQ ID NO.3: CCGGAATTCATGGCCGAGAACACCCTT, and a reverse primer with the sequence shown in SEQ ID NO.4: ATTTGCGGCCGCTCAGGTGCGGGTCCAGCGTT. The XynA fragment with Not I and EcoR I restriction sites was obtained by polymerase chain reaction.

[0052] PCR reaction system (50μL):

[0053]

[0054] PCR program: 94°C, 4min (pre-denaturation); 98°C, 10s (denaturation); 60°C, 5s (annealing); 72°C, 90s (extension); set 30 cycles; set after 72°C, 10min (insulation) The storage temperature is 4°C. The PCR product was gel-recovered and digested to recover the target gene, which was digested with the expression vector pGAPZαA and ligated overnight at 16°C, transformed into E.coliJM109, coated with an LB plate containing zecoin resistance, and cul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses Pichia yeast recombinant bacteria for expressing Streptomyces sp. FA1 (fertilization antigen 1) source xylanase, and belongs to the field of gene engineering. Plasmid pMD18-T-XynA serves as a template, a primer is designed, PCR (polymerase chain reaction) amplification is performed to obtain a target gene, and the nucleotide sequence of the gene is as shown in SEQ ID NO: 1 in a sequence table. The invention further discloses a production method of recombinant Pichia yeast engineering bacteria. The production method includes the steps: (1) synthesizing an autonomously replicating sequence PARS by whole gene synthesis technology; (2) building an expression vector pGAPZ alpha A-PARS; (3) building a recombinant expression vector pGAPZ alpha A-PARS-XynA; (4) transforming Pichia yeast hosts and screening positive converters; (5) shake-flask induced cultivation; (6) horizontally inducing a recombinant Pichia yeast engineering bacteria fermentation tank to produce the xylanase.

Description

technical field [0001] The invention relates to a Pichia recombinant bacterium expressing Streptomyces sp.FA1-derived xylanase, and belongs to the field of genetic engineering. Background technique [0002] Xylanases belong to the class of glycoside hydrolases [EC 3.2.1.x] and can be used in many fields. The addition of xylanase and other hemicellulases to feeds is beneficial to increase the nutrient breakdown of feeds; in the pulp and paper industry, xylanase can be used as a pre-bleach to treat pulp, thereby reducing the use of chemical reagents during pulp bleaching It can reduce the pollution to the environment; it can be used for baking flour products in the food field, which can improve the quality of flour products; xylanase is also used to prepare xylo-oligosaccharides. Hemp plants are rich in cellulose and are fiber raw materials in the textile industry. However, hemp plants contain impurities such as hemicellulose, lignin, and pectin, which are not conducive to te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N9/24C12N15/81A23K10/18C12R1/84
CPCA23K10/18C12N9/2402C12N15/815C12Y302/01
Inventor 吴敬吴丹潘阳
Owner JIANGNAN UNIV