Double sgRNA-mediated gene accurate modification method and application thereof

A sg508-w, cystic fibrosis technology, applied in the field of gene editing, can solve the problem of low efficiency and achieve the effect of improving the efficiency of gene editing

Active Publication Date: 2017-10-20
FOSHAN UNIVERSITY
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, although there are some studies on the repair of human CFTR mutation sites, the efficiency is not high or the use of screening marker genes is required

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double sgRNA-mediated gene accurate modification method and application thereof
  • Double sgRNA-mediated gene accurate modification method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 is used to construct the double sgRNA of cystic fibrosis model

[0050] HEK293 cell line was purchased from ATCC ( CRL-1573TM), culture medium composition: 10% fetal bovine serum (10438026, Gibco)+89% DMEM (11965, Gibco)+1% double antibody (15140122, Gibco), culture condition is 5% CO 2 , 37°C cell culture incubator.

[0051] Cystic fibrosis (Cystic fibrosis, CF) is a genetic disease, 70% of patients are caused by the deletion of the 508th amino acid nucleotide (CTT) encoded by the CFTR gene. In order to effectively construct a cystic fibrosis model, the present invention finally found that the following two sgRNAs can significantly improve the accuracy of cystic fibrosis model establishment through a large number of research experiments. The two sgRNA sequences are respectively:

[0052] sg1: CCUAUGAUGAAUAUAGAUACAGA (SEQ ID NO: 1);

[0053] sg508-W: CCAAAGAUGAUAUUUUCUUUAAU (SEQ ID NO: 2).

Embodiment 2

[0054] Example 2 Double sgRNA-mediated method for constructing a cystic fibrosis cell model

[0055] (1) Preparation of double sgRNA

[0056] 1.1 Synthetic primers sg1-F, sg508-W-F and sg-R:

[0057] sg1-F: TGTAATACGACTCACTATAGGTCTGTATCTATATTCATCATgttttagagctagaaatagc (SEQ ID NO: 3);

[0058] sg508-W-F: TGTAATACGACTCACTATAGGATTAAAAAAATATCATcttgttttagagctagaaatagc (SEQ ID NO: 4)

[0059] sg-R: AAAAGCACCGACTCGGTGCC (SEQ ID NO: 5).

[0060] 1.2 Preparation of double sgRNA transcription template

[0061] Using the px330 plasmid as a template (purchased from addgene, product number: Plasmid#42230), PCR amplification was performed to obtain the transcription templates of the double sgRNA (sg1 and sg508-W), respectively. The reaction systems are shown in Table 1 and Table 2.

[0062] The PCR amplification system of the transcription template of table 1sg1

[0063] Reagent

volume

Taq enzyme

0.4μl

10×Buffer

5μl

dNTP

8μl

10 nM sg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a double sgRNA-mediated gene accurate modification method and an application thereof. According to the invention, two strips of sgRNA are simultaneously used, a CF cell is taken as a model, directional deletion is carried out on nucleotide of the 508th sites amino acid for coding CFTR gene, the pathogenic genotype which is same with the deletion patients of 508th sites amino acid of the CFTR can be obtained, and the method found that compared with single sgRNA, the double sgRNA has higher efficiency for editing. The invention provides the more effective method for cell model construction and gene editing for the gene disease.

Description

technical field [0001] The invention belongs to the field of gene editing, and in particular relates to a double sgRNA-mediated precise gene modification method and its application, in particular to a double sgRNA-mediated method for constructing a cystic fibrosis cell model and its application. Background technique [0002] Gene editing technology has broad application prospects in the fields of agriculture and medicine, and technical methods are being continuously improved and innovated. The main direction of improvement is to improve the accuracy of gene editing. At present, gene editing mainly relies on the three major technologies of zinc finger nuclease (ZFN), TALEN and CRISPR / Cas9. The most widely used is CRISPR / Cas9, which uses one sgRNA, and the efficiency and accuracy still need to be improved. Cystic fibrosis (CF) is a genetic disease that can affect many parts of the body, with the lungs and digestive system most affected. Cystic fibrosis is most common in Caucas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N5/10C12N15/90
CPCC07K14/47C12N15/113C12N15/907C12N2310/10
Inventor阮进学李奎牟玉莲李训碧李华于辉
OwnerFOSHAN UNIVERSITY