Supercharge Your Innovation With Domain-Expert AI Agents!

SNP (single nucleotide polymorphism) Molecular marker for peroxisome proliferator-activated receptor alpha gene in Tibetan chicken and application thereof

A technology of peroxisomes and molecular markers, applied in the biological field, can solve problems such as the gaps in research on high-altitude adaptation of plateau animals, and achieve the effect of facilitating adaptation and stabilizing the secondary structure

Inactive Publication Date: 2017-11-21
SICHUAN AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] So far, there has been no research on the genetic variation of PPARa in Tibetan chickens, and the research on the function of this gene locus and its association with the high-altitude adaptation of plateau animals is still blank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP (single nucleotide polymorphism) Molecular marker for peroxisome proliferator-activated receptor alpha gene in Tibetan chicken and application thereof
  • SNP (single nucleotide polymorphism) Molecular marker for peroxisome proliferator-activated receptor alpha gene in Tibetan chicken and application thereof
  • SNP (single nucleotide polymorphism) Molecular marker for peroxisome proliferator-activated receptor alpha gene in Tibetan chicken and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Determination of the SNP molecular marker of the Tibetan chicken peroxisome proliferator-activated receptor alpha gene and the establishment of a method for detecting this site:

[0032] Using the chicken whole genome DNA containing the PPARα gene as a template, design a specific primer pair to amplify the chicken PPARα gene, send the amplified product to the company for first-generation sequencing, and judge the SNP site according to the peak map; without explanation The place is carried out according to the conventional method, which specifically includes the following steps:

[0033] (1) Design of specific primers: Taking the red jungle fowl sequence (NC_006088.4) published by NCBI as a reference, Primer5.0 was used to design PCR primers, and the primer pair P1 sequence of exon 4 was: upstream primer: TCATCAGTCAGGTCTCAGT, downstream Primers: CTACTATAACTTAGAGGCTCCT, the length of the amplified product is 605; the blood samples of different strains and individu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP (single nucleotide polymorphism) molecular marker for peroxisome proliferator-activated receptor alpha gene in Tibetan chicken and application thereof. The SNP molecular marker is positioned at site T29467C of exon 4 of the peroxisome proliferator-activated receptor alpha gene in Tibetan chicken. A kit for detecting the SNP molecular marker provided herein comprises a primer having a nucleotide sequence shown as in SEQ ID No. 1-2. The invention also provides a method of using the SNP site to identify genotypes of Tibetan chicken; the method comprises: acquiring genome DNA of a chicken; using the primer pair having the nucleotide sequence shown as in SEQ ID No. 1-2 to detect the genotype of site T1289C; selecting individuals with the genotype CC. The results show that the PPAR (peroxisome proliferator-activated receptor) alpha gene exon 4N(T29467C) site allele has significant differences in Tibetan chicken and plain chicken; the mutated PPAR alpha better helps Tibetan chicken adapt to the high-altitude environment.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a SNP molecular marker of Tibetan chicken peroxisome proliferator-activated receptor alpha gene and its application. Background technique [0002] Single nucleotide polymorphisms (singlenucleotide polymorphisms, SNPs) mainly refer to DNA sequence polymorphisms caused by variations at the nucleotide level of the genome, including single-base transitions, transversions, and single-base insertions / deletions Wait. SNPs have the following characteristics: (1) Large number and high coverage density, it is estimated that one will appear every 1000bp on average. It has been detected that 93% of human genes contain SNPs, and the distance of 98% of SNPs does not exceed 5kb. Therefore, a series of markers can be provided in or near almost every gene; (2) because SNPs generally only have 2 alleles Genes can be genotyped only through a simple "+ / -" method during detection, which mak...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 钟成麟赵小玲舒刚李思辰刘嘉李富贵秦子越覃飞朱庆王彦尹华东
Owner SICHUAN AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com