Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of miR-155 as molecular marker in diagnosis of preeclampsia

A molecular marker, 1.mir-155 technology, applied in the field of biomedicine, can solve the problems of not being able to reflect the progress of PE patients in time, and the pathogenesis of PE is unclear

Inactive Publication Date: 2017-11-28
XIAN MEDICAL UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

24-hour urine protein quantification is an important basis for evaluating the severity of the disease. However, due to the rapid progression of PE, and 24-hour urine protein quantification often takes 1-2 days to make a definite diagnosis, it is not possible to use 24-hour urine protein quantification as the basis for diagnosis. Timely reflect the progress of PE patients
At the same time, due to the unclear pathogenesis of PE, there are no effective predictive indicators for clinical application. When pregnant women develop clinical symptoms such as hypertension and proteinuria, they often have developed to the advanced stage of the disease. Therefore, how to quickly and accurately evaluate the condition of PE patients is an important issue we face

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-155 as molecular marker in diagnosis of preeclampsia
  • Application of miR-155 as molecular marker in diagnosis of preeclampsia
  • Application of miR-155 as molecular marker in diagnosis of preeclampsia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0021] The nucleotide sequence of miR-155 in the present invention is shown in SEQ.ID.NO.1. The study found that miR-155 has a clear role in the early diagnosis of eclampsia, and further found that miR-155 provides a reliable indicator and basis for the diagnosis, treatment and assessment of PE.

[0022] The nucleotide sequence of miR-155 studied in the present invention is as follows:

[0023] ACACTCCAGCTGGGTTAATGCTAATCGTGATA (same as SEQ.ID.NO.1)

[0024] The specific experiments and results of the early diagnosis of eclampsia caused by oxidative stress by miR-155 provided by the present invention are described in detail below.

[0025] 1. General data analysis

[0026] Serum and urine samples from 20 patients with preeclampsia and 20 patients with normal pregnancy were collected. There were 13 patients with severe preeclampsia and 7 pati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of miR-155 as a molecular marker in diagnosis of preeclampsia (PE). The nucleotide sequence of miR-155 is shown as SEQ. ID. NO.1. By means of experiments, the invention finds that the expression of miR-155 in sera of PE patients is significantly enhanced compared with normal pregnant women, and the ratio of PE patients' serum miRNA to urine miRNA is significantly increased compared with a normal pregnancy group, and ROC mapping shows that miR-155 has medium diagnostic value on preeclampsia. Therefore, through determination of patients' peripheral circulation miR-155, and combination of the clinicopathological features thereof, the invention provides a reliable index and basis for diagnosis, treatment and disease assessment of preeclampsia.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, in particular to the application of miR-155 as a molecular marker in diagnosing preeclampsia. Background technique [0002] Preeclampsia (PE) is a common obstetric complication and one of the main causes of maternal and perinatal morbidity and mortality. In 2006, WHO released data showing that deaths due to PE or eclampsia accounted for 15%-20% of maternal deaths in developing countries. According to the severity of the disease, PE is divided into mild and severe; according to the time of onset, it is divided into early-onset and late-onset. [0003] The pathophysiology of PE can be divided into two stages: in the first stage, shallow implantation of villus leads to reduced placental perfusion; in the second stage, extensive activation and damage of vascular endothelial cells throughout the body of the pregnant woman leads to multiple organ dysfunction. At present, the pathogenesis of these...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/112C12Q2600/158C12Q2600/178
Inventor 魏明甘露苏兴利梁飞张欣王婷曹慧玲胥晓丽徐天娇
Owner XIAN MEDICAL UNIV