Application of miR-155 as molecular marker in diagnosis of preeclampsia
A molecular marker, 1.mir-155 technology, applied in the field of biomedicine, can solve the problems of not being able to reflect the progress of PE patients in time, and the pathogenesis of PE is unclear
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0021] The nucleotide sequence of miR-155 in the present invention is shown in SEQ.ID.NO.1. The study found that miR-155 has a clear role in the early diagnosis of eclampsia, and further found that miR-155 provides a reliable indicator and basis for the diagnosis, treatment and assessment of PE.
[0022] The nucleotide sequence of miR-155 studied in the present invention is as follows:
[0023] ACACTCCAGCTGGGTTAATGCTAATCGTGATA (same as SEQ.ID.NO.1)
[0024] The specific experiments and results of the early diagnosis of eclampsia caused by oxidative stress by miR-155 provided by the present invention are described in detail below.
[0025] 1. General data analysis
[0026] Serum and urine samples from 20 patients with preeclampsia and 20 patients with normal pregnancy were collected. There were 13 patients with severe preeclampsia and 7 pati...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com