Unlock instant, AI-driven research and patent intelligence for your innovation.
Primer, kit and method for detecting pseudomonas aeruginosa and integron in water
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of Pseudomonas aeruginosa and detection kits, applied in biochemical equipment and methods, microbe determination/testing, DNA/RNA fragments, etc., can solve the problem of Pseudomonas aeruginosa and integron detection that have not been reported, etc. problems, to achieve good industrialization prospects, fast detection, and easy to use
Inactive Publication Date: 2017-12-01
蔡先全
View PDF6 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0009] However, there are few reports on the analysis of copy number based on the droplet digital PCR platform, let alone the detection of Pseudomonas aeruginosa and integrons.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0043] The present invention detects the primers of Pseudomonas aeruginosa and integron int1 in water, and the sequences of the primers are respectively:
[0044] Upstream primer P.AF: TGGTAGTCCACGCCGTAAA
[0045] Downstream primer P.AR:CAGACTGCGATCCGGACTACG
[0046] Probe P.AP: TCGACCGCCTGGGGAGTACG
[0047] Upstream primer int1F: ATCCTGCACGGTTCGAATGT
[0048] Downstream primer Int1R: TCCTCGGTTTTCTGGAAGGC
[0049] Probe IntlP: GCCCTCCCGCACGATGATCG.
Embodiment 2
[0051] The present invention is a kit for detecting Pseudomonas aeruginosa and integron int1 in water, wherein the 20 μL reaction system includes the following components:
[0052] Among them, 10.0 μL of 2×ddPCR Super Mix, 1.0 μL of Pseudomonas aeruginosa and int1 forward and reverse primers, 1.0 μL of each probe, and 4.0 μL of DNA template.
[0053] Wherein the primer sequences are as follows:
[0054] Upstream primer P.AF: TGGTAGTCCACGCCGTAAA
[0055] Downstream primer P.AR:CAGACTGCGATCCGGACTACG
[0056] Probe P.AP: TCGACCGCCTGGGGAGTACG
[0057] Upstream primer int1F: ATCCTGCACGGTTCGAATGT
[0058] Downstream primer Int1R: TCCTCGGTTTTCTGGAAGGC
[0059] Probe IntlP: GCCCTCCCGCACGATGATCG.
Embodiment 3
[0061] A kind of kit of the present invention detects Pseudomonas aeruginosa and integron int1 in water, wherein reaction system comprises following components:
[0062] Among them, 10.0 μL of 2×ddPCR Super Mix, 0.1 μL of forward and reverse primers for Pseudomonas aeruginosa and int1, 0.1 μL of each probe, and 4.0 μL of DNA template.
[0063] Wherein the primer sequences are as follows:
[0064] Upstream primer P.AF: TGGTAGTCCACGCCGTAAA
[0065] Downstream primer P.AR:CAGACTGCGATCCGGACTACG
[0066] Probe P.AP: TCGACCGCCTGGGGAGTACG
[0067] Upstream primer int1F: ATCCTGCACGGTTCGAATGT
[0068] Downstream primer Int1R: TCCTCGGTTTTCTGGAAGGC
[0069] Probe IntlP: GCCCTCCCGCACGATGATCG.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a primer, a kit and a method for detecting pseudomonas aeruginosa and integron in water, and aims to overcome the shortcomings of the prior art. The sequence of the primer and a probe sequence include an upstream primer P.AF, a downstream primer P.AR, a probe P.AP, an upstream primer int1F, a downstream primer int1R and a probe int1P. The kit is reasonable in composition and proportion, convenient to use, rapid and accurate in detection and applicable to double ddPCR detection of the pseudomonas aeruginosa and integron int1 in the water. The method is used for detecting the pseudomonas aeruginosa and the integron int1 in the water by the kit, simple, convenient and rapid in detection and accurate in detection result.
Description
technical field [0001] The invention relates to a double droplet digital PCR detection kit for detecting Pseudomonas aeruginosa and integron int1 in water, and also relates to a kit for detecting Pseudomonas aeruginosa and integron int1 in drinking water by using the kit method. Background technique [0002] Pseudomonas aeruginosa Pseudomonas aeruginosa formerly known as Pseudomonas aeruginosa. It is widely distributed in nature and is one of the most common bacteria present in soil. All kinds of water, air, skin of normal people, respiratory tract and intestinal tract etc. have this bacterium to exist. The important condition for the existence of this bacteria is a humid environment. The bacterium is a common environmental microorganism. Because it has low nutritional requirements and is good at using various carbon sources and ammoniated compounds as nitrogen sources, it widely exists in water, soil, food, and hospitals. The United States, Canada, Europe, Japan, Brazil...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More