Unlock instant, AI-driven research and patent intelligence for your innovation.

PET hydrolase mutant with high catalytic activity

A technology of mutants and hydrolytic enzymes, applied in the direction of hydrolytic enzymes, biochemical equipment and methods, applications, etc., can solve the problems of low degradation efficiency of PET plastics, insufficient catalytic function of the key enzyme Ec_PETase, and difficulty in industrial application, etc., to achieve reduction Effects of degradation cost, high enzyme activity, and simplified degradation steps

Active Publication Date: 2018-02-09
UNIV OF ELECTRONIC SCI & TECH OF CHINA
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although the discovery of Ideonella sakaiensis 201-F6 strain and the functional analysis of the key enzyme PET hydrolase (PETase) have brought hope for the biodegradation of PET plastics, the efficiency of Ideonella sakaiensis 201-F6 wild-type strains for the degradation of PET plastics is low, The catalytic function of the key enzyme Ec_PETase involved in PET degradation metabolism is not high enough
It is difficult to directly realize the industrial application of PET plastic biodegradation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PET hydrolase mutant with high catalytic activity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1, Escherichia coli secreted often expressed PET hydrolase (Ec_PETase) mutation hotspot screening

[0035] 1. Construction of 3D model of PETase

[0036]Enter the amino acid sequence of PETase: (GenBank accession number, GAP38373.1) into the three websites I-TASSER, MULTICOM, and ROBETTA to obtain the 3D model of PETase, use Rampage to evaluate the obtained model, and select 3 models for follow-up Docking experiment.

[0037] 2. Use Auto Dock software for substrate docking

[0038] Since the pNPB method is a commonly used lipase activity detection method, pNPB, the product of lipase hydrolysis, has an absorption peak at 405nm under the conditions of 34°C and pH=7.4. Therefore, we used pNPB as the substrate for molecular docking. GaussView was used to draw its 3D structure, and dynamic optimization was performed to finally obtain the most stable conformation of pNPB in space. The best results were obtained after docking simulation analysis.

[0039] 3 mutati...

Embodiment 2

[0041] Example 2. Construction of site-directed mutants of mutation hotspots Trp159, Gln182, Ala183, Ile208 and Ser238.

[0042] The primers used in the experiment are listed in Table 1 below:

[0043] Table 1 Primers used for construction of site-directed mutants

[0044] Primer

serial number

Primer sequence (5'-3')

W159H-Forward

SEQ ID No.9

TATGGGTCATAGCATGGGTGGCGGTGGCAGC

W159H-Reverse

SEQ ID No.10

CACCCATGCTATGACCCATAACGCCCATACG

Q182L-F

SEQ ID No.11

GGCGCCGCTGGCGCCGTGGGACAGCAGCTTC

Q182L-R

SEQ ID No.12

CACGGCGCCAGCGGCGCCGCAGCTTTCAGGCT

A183T-F

SEQ ID No.13

CGCCGCAAACCCCCGTGGGACAGCAGCTTCAGC

A183T-R

SEQ ID No.14

TCCCACGGGGTTTGCGGCGCCGCAGCTTTCAG

I208V-F

SEQ ID No.15

ACGATAGCGTTGCGCCGGTGAACAGCAGCGCG

I208V-R

SEQ ID No.16

ACCGGCGCAACGCTATCGTTCTCGCACGCAAA

S238F-F

SEQ ID No.17

GCAGCCACTTCTGCGCGAACAGCGGTAACAGC

S238F-R

SEQ ID ...

Embodiment 3

[0047] Example 3, EcPETase recombinant expression and activity evaluation

[0048] 1. Take pUC57-EcPETase genetically engineered Escherichia coli mutants respectively, culture them with shaking in LB liquid medium at 37°C and 180rpm for 4 hours (OD600=1.5), centrifuge to separate the protein secreted into the extracellular space and concentrate it to 0.025mg / ml is used for the determination of enzyme catalytic activity.

[0049] 2. Obtain a concentrated supernatant sample of the overnight culture product of the pUC57-EcPETase genetically engineered E. coli strain, using pNPB as the substrate. References: "oshida S, Hiraga K, Takehana T, Taniguchi I, Yamaji H, Maeda Y, Toyohara K , Miyamoto K, Kimura Y, Oda K.2016.A bacterium that degrades and assimilates poly(ethylene terephthalate).Science,351(6278):1196-1199."The experimental method disclosed in the test pUC57-EcPETase genetically engineered Escherichia coli strain Catalytic activity of EcPETase in culture medium. Add 100 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of protein engineering, and specifically relates to a PET hydrolase mutant with high catalytic activity. The technical problem to be solved by the invention is thatthe activity of PET hydrolase (PETase) derived from Ideonella sakaiensis 201-F6 bacterial strains at present is still unsatisfactory. The technical scheme of the technical problem solved by the invention is to provide the PET hydrolase mutant. Five mutation hot spots are obtained through a large number of researches of PET hydrolase (PETase); fourteen mutants are constructed by adopting a site-specific mutagenesis technology, and finally the activity of ETase enzyme of two screened mutants are improved compared with that of wild type Ec_PETase, and the PET hydrolase mutant has preferable application prospects.

Description

technical field [0001] The invention belongs to the technical field of Escherichia coli genetic engineering, in particular to a PET hydrolase (Ec_PETase) mutant derived from Escherichia coli engineering bacteria with improved catalytic activity. Background technique [0002] Polyethylene terephthalate (PET) is one of the most common plastic materials. In 2013, the annual output of PET reached 56 million tons, accounting for about 1 / 5 of the global plastic output. According to statistics, PET is currently the most recycled plastic material, and its recycling rates in the United States and the European Union are 31% and 50% respectively. Although the PET polymer is only composed of two simple monomers connected by an ester bond, the ester bond is relatively strong and difficult to degrade naturally. Tens of millions of tons of PET plastic waste are difficult to be effectively disposed of every year, which is extremely harmful to the environment. [0003] Currently existing PE...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/18C12N15/55
CPCC12N9/18
Inventor 汤丽霞李思扬张勇郑雪莲刘炳麟邹佳佳
Owner UNIV OF ELECTRONIC SCI & TECH OF CHINA