Molecular marker for rapidly identifying hyriopsis-cumingii sex
A molecular marker, spinnaker technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as gender identification difficulties, improve breeding efficiency, low sampling requirements, and accuracy. high effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0011] A molecular marker method for quickly identifying the sex of Triangle sailfish, comprising the following steps:
[0012] 1) Extraction of genes: Extract the DNA of Hypophyllum sinensis by phenol-chloroform extraction method, dissolve in TE, and store at low temperature;
[0013] 2) PCR amplification reaction: the amplification system is: take 10×buffer 2.5ul, dNTP (10mmol / L) 2.0uL, upstream and downstream primers (10pmol / l) 1uL each, rTaq polymerase 0.3uL, DNA template 100ng, add Double-distilled water to 25uL; PCR amplification conditions are: pre-denature the mixture at 94°C for 5min, then denature at 94°C for 20s, anneal at 60°C for 20s, and extend at 72°C for 20s for 35 cycles, and finally extend at 72°C for 1min; upstream primers The sequence is: AGGCACGATTCGTGTGTCCC, the downstream primer sequence is: GCTCAATTCCTCGAAGCTAC;
[0014] 3) Sequencing comparison: Purify and sequence the amplified product, and compare it with the molecular marker whose nucleotide sequen...
Embodiment 2
[0016] A molecular marker method for quickly identifying the sex of Triangle sailfish, comprising the following steps:
[0017] 1) Extraction of genes: Extract the DNA of Hypophyllum sinensis by phenol-chloroform extraction method, dissolve in TE, and store at low temperature;
[0018] 2) PCR amplification reaction: Mix 2.5ul of 10×buffer, 2.0uL of dNTP (10mmol / L), 1uL of upstream and downstream primers (10pmol / l), 0.3uL of rTaq polymerase, and 100ng of DNA template, add double distilled water to 25uL, then add 1.2ng tetrachloromandelic acid and 0.7ng methyl cinnamate; PCR amplification conditions are: pre-denature the mixture at 94°C for 5min, then denature at 94°C for 20s, anneal at 60°C for 20s, and extend at 72°C for 20s. 35 cycles, and finally extended at 72°C for 1 min; the sequence of the upstream primer is: AGGCACGATTCGTGTGTCCC, and the sequence of the downstream primer is: GCTCAATTCCTCGAAGCTAC; the added tetrachloromandelic acid, methyl cinnamate and 10×buffer have a ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap