Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker for rapidly identifying hyriopsis-cumingii sex

A molecular marker, spinnaker technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as gender identification difficulties, improve breeding efficiency, low sampling requirements, and accuracy. high effect

Inactive Publication Date: 2018-02-23
JINHUA VOCATIONAL TECH COLLEGE
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is a significant difference in the pearl-producing performance between male and female of sexually mature Trigonalis, and males have better pearl-bearing performance, but it is difficult to visually identify the sex of Trigonalis in terms of morphology
The current method of gender identification is generally to dip the gonads of mature Hypophyllum clam and observe the gametes under a microscope, but this method is only applicable to mature Hypophyllum mussels that are in the reproductive period

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0011] A molecular marker method for quickly identifying the sex of Triangle sailfish, comprising the following steps:

[0012] 1) Extraction of genes: Extract the DNA of Hypophyllum sinensis by phenol-chloroform extraction method, dissolve in TE, and store at low temperature;

[0013] 2) PCR amplification reaction: the amplification system is: take 10×buffer 2.5ul, dNTP (10mmol / L) 2.0uL, upstream and downstream primers (10pmol / l) 1uL each, rTaq polymerase 0.3uL, DNA template 100ng, add Double-distilled water to 25uL; PCR amplification conditions are: pre-denature the mixture at 94°C for 5min, then denature at 94°C for 20s, anneal at 60°C for 20s, and extend at 72°C for 20s for 35 cycles, and finally extend at 72°C for 1min; upstream primers The sequence is: AGGCACGATTCGTGTGTCCC, the downstream primer sequence is: GCTCAATTCCTCGAAGCTAC;

[0014] 3) Sequencing comparison: Purify and sequence the amplified product, and compare it with the molecular marker whose nucleotide sequen...

Embodiment 2

[0016] A molecular marker method for quickly identifying the sex of Triangle sailfish, comprising the following steps:

[0017] 1) Extraction of genes: Extract the DNA of Hypophyllum sinensis by phenol-chloroform extraction method, dissolve in TE, and store at low temperature;

[0018] 2) PCR amplification reaction: Mix 2.5ul of 10×buffer, 2.0uL of dNTP (10mmol / L), 1uL of upstream and downstream primers (10pmol / l), 0.3uL of rTaq polymerase, and 100ng of DNA template, add double distilled water to 25uL, then add 1.2ng tetrachloromandelic acid and 0.7ng methyl cinnamate; PCR amplification conditions are: pre-denature the mixture at 94°C for 5min, then denature at 94°C for 20s, anneal at 60°C for 20s, and extend at 72°C for 20s. 35 cycles, and finally extended at 72°C for 1 min; the sequence of the upstream primer is: AGGCACGATTCGTGTGTCCC, and the sequence of the downstream primer is: GCTCAATTCCTCGAAGCTAC; the added tetrachloromandelic acid, methyl cinnamate and 10×buffer have a ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker for rapidly identifying the hyriopsis-cumingii sex, and also discloses a molecular marker method for rapidly identifying the hyriopsis-cumingii sex. The molecular marker and molecular marker method for rapidly identifying the hyriopsis-cumingii sex have the advantages that the molecular marker with the nucleotide sequence of SEQ ID NO.1 is applied to identification of young hyriopsis cumingii, is simple and convenient and fast, low in sampling requirement and high in identification-result accuracy, is not influenced by the tissue specificity and the environment, and has the important effect on improving culture benefits of fresh water pearl mussels; the lengths of used upstream primers and downstream primers are suitable, the stable dimer and hairpin structure is difficult to form between the primers, and the initiating efficiency of false priming sites is extremely low.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular marker and an identification method for quickly identifying the sex of the spinosa mussel. Background technique [0002] As the most important freshwater pearl-growing mussel in my country, the triangular sail clam has a high survival rate and good quality pearls. The pearls produced can be used as decorations and handicrafts, and those whose quality has been checked can be used as medicinal materials. The spinnaker inhabits large and medium-sized lakes and rivers, but prefers to live in waters with clear water and fast currents. It is mainly distributed in Jiangsu, Zhejiang, Jiangxi, Hubei, Hunan and Anhui provinces. There are significant differences in pearl-producing performance between males and females of sexually mature S. sailosaurs, and males have better bead-bearing performance. However, it is difficult to visually identify the sex of S....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124
Inventor 叶容晖
Owner JINHUA VOCATIONAL TECH COLLEGE