Highly specific CRISPR genome editing system

A genome editing, high-specificity technology, applied in the field of high-specificity CRISPR genome editing system, can solve problems hindering the application of genome editing technology

Active Publication Date: 2018-03-13
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF6 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the off-target effects in genome editing have been hindering the wider application of genome editing technology. Therefore, there is an urgent need to develop genome editing technology with stronger targeting specificity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Highly specific CRISPR genome editing system
  • Highly specific CRISPR genome editing system
  • Highly specific CRISPR genome editing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Example 1 Design and screening of highly active gRNA targeting Cas9

[0084] Experimental steps:

[0085] 1) Through sequence alignment, design five highly active gRNAs targeting the Cas9 sequence, and the gRNA sequences are shown in Table 1.

[0086] 2) Clone five gRNAs into the lentiCRISPR v2 vector (addgene#52961)

[0087] 3) Infect 293T cells after packaging lentivirus respectively

[0088] 4) The cells were harvested at 48h and 96h after infection, and the Cas9 gene cleavage of the cells was analyzed by the T7E1 detection kit; and the Cas9 protein expression was analyzed by Western blotting reaction

[0089] Table 1 Targeting gRNA sequence designed for Cas9 and primer sequence information for T7E1 detection

[0090]

[0091] Experimental results such as figure 2 As shown, the left figure shows the T7E1 detection results. In the negative control group, the band did not cut, but in the Cas9guide-2 and Cas9guide-3 groups, the band clearly cut, showing guide-2 ...

Embodiment 2

[0092] Example 2 Construction of SeT CRISPR lentiviral vector

[0093] Experimental steps:

[0094] 1) In the synthetic plasmid pmU6-gRNA (synthesized by Jinweizhi Company, its sequence is shown in SEQ ID NO.11), which contains the backbone sequence of the guide RNA targeting the genome of the target cell and the mouse U6 promoter, and in the mouse The 5' of the U6 promoter and the 3' of the gRNA backbone sequence have an EcoRI restriction enzyme cleavage site;

[0095] The sequence of the synthetic plasmid pmU6-gRNA is as follows (SEQ ID NO.11):

[0096] GAATTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCCACCTTGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTA...

Embodiment 3

[0099] Example 3 Verify whether there is a difference in the gene targeting efficiency between the SeT CRISPR lentiviral system and the common CRISPR lentiviral system

[0100] Experimental steps:

[0101] 1) Taking the human P53 gene as an example, construct a common CRISPR lentivirus system (marked as "P53gRNA") and a SeT CRISPR lentivirus system (marked as "P53gRNA+Cas9gRNA")

[0102] 2) Infect human liver cancer cell line Huh7 after packaging lentivirus respectively

[0103] 3) Cells were harvested on day 4 and day 8 after infection, and the cleavage of P53 and Cas9 target sites were detected by T7E1 kits

[0104] Table 2. Targeting gRNA sequences designed for P53, and primer sequence information for T7E1 detection

[0105]

[0106] Experimental results such as image 3 As shown, in the P53T7E1 detection results, the negative control lentiCRISPR v2 group bands did not cut, while the P53gRNA and P53gRNA+Cas9gRNA group bands were clearly cut (the target band was 245bp+...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a highly specific CRISPR genome editing system. The gRNA of a target Cas9 gene is introduced into a CRISPR / Cas9 genome editing system, when (or after) target cell genome editingis performing, the gRNA of the target Cas9 gene can mediate the cutting of Cas9 gene, thus the expression time of the Cas9 gene is prominently reduced, the off-target effect caused by long term expression of Cas9 in a CRISPR system is reduced, and the targeting specificity is enhanced.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular, the invention relates to a highly specific CRISPR genome editing system. Background technique [0002] Genome Editing technology is a technology that can conduct targeted modification of the target genome, so as to conduct research and gene therapy on genes with unknown functions. Artificial endonuclease-mediated genome editing technology is currently the most widely used. Its advantage is that it can get rid of the dependence of traditional technology on embryonic stem cells and has a wide range of applications. It has great potential in clinical application. Artificial endonuclease-mediated genome editing technologies mainly include zinc finger nuclease technology (ZFNs), transcription activator-like nuclease technology (TALENs) and CRISPR / Cas technology. [0003] ZFNs is the earliest developed general genome editing technology, which can be used to implement site-specific knockout ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N15/113C12N15/867C12N5/10
CPCC12N9/22C12N15/113C12N15/1137C12N15/8509C12N15/86C12N2310/10C12N2740/15043C12N2800/107C12N2810/10
Inventor丁秋蓉陈彦好
OwnerSHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI