Lentiviral vector for silencing Puralpha gene
A lentiviral vector, alpha gene technology, applied in the field of RNA silencing, can solve the problems of cumbersome operation, high price, long cycle, etc., and achieve the effect of less dosage, high transfection efficiency, efficient and stable expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] A lentiviral vector for Purα gene silencing, the lentiviral vector comprising the PurαRNAi oligonucleotide sequence for Purα gene silence; the Purα gene target site corresponding to the PurαRNAi oligonucleotide sequence is 772 -791, the gene sequence of the gene target 772-791 in the Purα gene is: ACCGTGCCCTACAAGGTGTG (SEQ ID NO: 1).
[0021] The Pur α RNAi oligonucleotide sequence used for Pur α gene silence includes a sense strand sequence and an antisense strand sequence, the sense strand sequence being: 5'-CCGGACCGTGCCCTACAAGGTGTGCTCGAGCACACCTTTGTAGGGCACGGTTTTT-3' (SEQ ID NO:2), the antisense The strand sequence was: 5'-AATTAAAAACCGTGCCCTACAAGGTGTGCTCGAGCACACCTTGTAGGGCACGGT-3' (SEQ ID NO: 3).
[0022] The construction method of the PurαRNAi oligonucleotide sequence used for Purα gene silence is: design and synthesize the PurαRNAi oligonucleotide sequence comprising a sense strand and an antisense strand, and the sense strand gene sequence is as shown in SEQ ID NO:2 ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap