Lentiviral vector for silencing Puralpha gene

A lentiviral vector, alpha gene technology, applied in the field of RNA silencing, can solve the problems of cumbersome operation, high price, long cycle, etc., and achieve the effect of less dosage, high transfection efficiency, efficient and stable expression

Inactive Publication Date: 2018-05-04
NINGXIA MEDICAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although there are currently many systems available for RNA interference (RNA Interference RNAi) on the market, such as Invitrogen's Block-It Lentiviral RNAi Expression System, these systems have the disadvantages of cumbersome operation, long cycle time, and high price. It has brought certain difficulties to its wide application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentiviral vector for silencing Puralpha gene
  • Lentiviral vector for silencing Puralpha gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] A lentiviral vector for Purα gene silencing, the lentiviral vector comprising the PurαRNAi oligonucleotide sequence for Purα gene silence; the Purα gene target site corresponding to the PurαRNAi oligonucleotide sequence is 772 -791, the gene sequence of the gene target 772-791 in the Purα gene is: ACCGTGCCCTACAAGGTGTG (SEQ ID NO: 1).

[0021] The Pur α RNAi oligonucleotide sequence used for Pur α gene silence includes a sense strand sequence and an antisense strand sequence, the sense strand sequence being: 5'-CCGGACCGTGCCCTACAAGGTGTGCTCGAGCACACCTTTGTAGGGCACGGTTTTT-3' (SEQ ID NO:2), the antisense The strand sequence was: 5'-AATTAAAAACCGTGCCCTACAAGGTGTGCTCGAGCACACCTTGTAGGGCACGGT-3' (SEQ ID NO: 3).

[0022] The construction method of the PurαRNAi oligonucleotide sequence used for Purα gene silence is: design and synthesize the PurαRNAi oligonucleotide sequence comprising a sense strand and an antisense strand, and the sense strand gene sequence is as shown in SEQ ID NO:2 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention mainly belongs to the technical field of silencing RNA (ribonucleic acid), and particularly relates to a lentiviral vector for silencing a Puralpha gene. The lentiviral vector comprisesa Puralpha RNAi (RNA interfere) oligonucleotide sequence for silencing the Puralpha gene, wherein a gene target of the Puralpha gene corresponding to the Puralpha RNAi oligonucleotide sequence is 772-791, and the gene sequence of the Puralpha gene at the gene target 772-791 is ACCGTGCCCTACAAGGTGTG (SEQ ID NO:1). The lentiviral vector for silencing the Puralpha gene has the advantages that the transfection efficiency is high, and the usage amount is small; the expression of the Puralpha gene can be efficiently and stably inhibited.

Description

technical field [0001] The invention mainly belongs to the technical field of RNA silencing, and in particular relates to a lentiviral vector used for purα gene silencing. Background technique [0002] Knocking out the target gene in the process of gene analysis is an effective method, but in the actual operation process, the knockout of the target gene has the problems of long cycle and high cost, and some systems of the target gene Sexual knockout will cause offspring animals to die in the embryonic period or die immediately after birth, and the purpose of genetic analysis cannot be achieved. [0003] The emergence of RNA interference technology provides an effective way to solve this problem. The gene silencing method based on RNA interference technology enables people to effectively study the function of the target gene. Compared with gene knockout, RNA interference technology-based The gene silencing technology (hereinafter referred to as RNA silencing technology) has ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N15/113
CPCC12N15/86C07K14/47C12N15/113C12N2310/14C12N2740/15043
Inventor 袁程敏崔建奇贾中发
Owner NINGXIA MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap