How to judge whether the PCR result is a false positive
A false positive and template technology, which is applied in the field of molecular biology, can solve the problems of false positive, high technical requirements, and increased experimental costs, and achieve the effect of low cost and high reliability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] This embodiment is an example of determining whether the rice transgenic plant is positive.
[0018] 1. Extract transgenic rice genomic DNA, the concentration is about 500ng / ul.
[0019] Transgenic rice is screened with hygromycin, so whether the hygromycin gene (Hyg) is detected on the genome is used as the basis for judging whether the transgene is successful.
[0020] 2. Construct a vector containing positive internal reference template fragments.
[0021] The original fragment on Hyg is shown in SEQ ID NO.1, which is used as the target gene template; the sequence of the synthesized mutated Hyg fragment (hyg(m)) is shown in SEQ ID NO.2, and used as the internal reference template.
[0022] Using the following primers, as shown in the sequence table SEQ ID NO.3-4, the Hyg target gene template and the Hyg(m) internal reference template can be amplified with equal efficiency:
[0023] Hyg-F:acaagccaaccacggcctcc
[0024] hyg-R:atcgctgcggccgatcttag
[0025] The constr...
Embodiment 2
[0094] This embodiment is an example of determining whether the wheat transgenic plants are true positive plants.
[0095] The wheat genome is about 17 000 000 000bp, and each ul 500ng / ul wheat genomic DNA contains about N=500*6.02*10 23 / (650*17000000000*1000000000)=54*500=27000 copies. When the molecular quantity of the positive internal reference template is 1 / 10 of the genome quantity, it is necessary to add 100ng / ul pUC18-HYG(m) plasmid
[0096] 27000 / 10 / (306400397*100)=8.7*10 -8 ul, or a simple calculation method: 3.2*10 -6 *
[0097] 466M / 17000M=8.7*10 -8 ul (466M is the rice genome size, 17000M is the wheat genome size, 3.2*10 -6 It is the volume of reference plasmid added when testing rice under the same conditions). The method for judging true positive plants after amplification is the same as in Example 1.
Embodiment 3
[0099] The difference between this example and Example 1 is that the further sequencing analysis uses a first-generation sequencing method.
[0100] In this embodiment, two transgenic rice plants are taken as an example. The two rice plants are respectively denoted as Hygm1 plant and Hygm2 plant, both of which contain a target gene template (sequence shown in SEQ ID NO.1) and an internal reference template (sequence shown in SEQ ID NO.1). shown in NO.2).
[0101] Hygm1 plant: The final PCR product obtained is subjected to first-generation sequencing, and the sequencing result file hygm1.ab1 is obtained, and the peak data obtained by sequencing and the homologous sequence (internal reference template and target gene template SEQ ID NO.1 ~2) Submit them together to the computer program for comparison, and the result output is shown in the following table:
[0102] Table 1
[0103]
[0104] Hygm2 plant: The final PCR product obtained is subjected to first-generation sequenci...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


