Unlock instant, AI-driven research and patent intelligence for your innovation.

How to judge whether the PCR result is a false positive

A false positive and template technology, which is applied in the field of molecular biology, can solve the problems of false positive, high technical requirements, and increased experimental costs, and achieve the effect of low cost and high reliability

Active Publication Date: 2021-11-02
海南伯远生物科技有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PCR technology has high sensitivity and has been widely used. However, as a necessary solution for gene detection, it also has shortcomings, because it is too sensitive, and it is easy to be polluted by trace DNA in the environment, resulting in false positives. For example, in the experiment of transgenic detection Among them, because marker genes such as gus and hyg are often amplified, these fragments can still be amplified after a period of time without adding any templates. This is a headache encountered by many biological laboratories, so that the test results Unreliable, have to rely on southern blot technology as the final positive identification standard of transgene
However, the experimental technology of southern blot is high, which increases the cost of the experiment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • How to judge whether the PCR result is a false positive
  • How to judge whether the PCR result is a false positive
  • How to judge whether the PCR result is a false positive

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] This embodiment is an example of determining whether the rice transgenic plant is positive.

[0018] 1. Extract transgenic rice genomic DNA, the concentration is about 500ng / ul.

[0019] Transgenic rice is screened with hygromycin, so whether the hygromycin gene (Hyg) is detected on the genome is used as the basis for judging whether the transgene is successful.

[0020] 2. Construct a vector containing positive internal reference template fragments.

[0021] The original fragment on Hyg is shown in SEQ ID NO.1, which is used as the target gene template; the sequence of the synthesized mutated Hyg fragment (hyg(m)) is shown in SEQ ID NO.2, and used as the internal reference template.

[0022] Using the following primers, as shown in the sequence table SEQ ID NO.3-4, the Hyg target gene template and the Hyg(m) internal reference template can be amplified with equal efficiency:

[0023] Hyg-F:acaagccaaccacggcctcc

[0024] hyg-R:atcgctgcggccgatcttag

[0025] The constr...

Embodiment 2

[0094] This embodiment is an example of determining whether the wheat transgenic plants are true positive plants.

[0095] The wheat genome is about 17 000 000 000bp, and each ul 500ng / ul wheat genomic DNA contains about N=500*6.02*10 23 / (650*17000000000*1000000000)=54*500=27000 copies. When the molecular quantity of the positive internal reference template is 1 / 10 of the genome quantity, it is necessary to add 100ng / ul pUC18-HYG(m) plasmid

[0096] 27000 / 10 / (306400397*100)=8.7*10 -8 ul, or a simple calculation method: 3.2*10 -6 *

[0097] 466M / 17000M=8.7*10 -8 ul (466M is the rice genome size, 17000M is the wheat genome size, 3.2*10 -6 It is the volume of reference plasmid added when testing rice under the same conditions). The method for judging true positive plants after amplification is the same as in Example 1.

Embodiment 3

[0099] The difference between this example and Example 1 is that the further sequencing analysis uses a first-generation sequencing method.

[0100] In this embodiment, two transgenic rice plants are taken as an example. The two rice plants are respectively denoted as Hygm1 plant and Hygm2 plant, both of which contain a target gene template (sequence shown in SEQ ID NO.1) and an internal reference template (sequence shown in SEQ ID NO.1). shown in NO.2).

[0101] Hygm1 plant: The final PCR product obtained is subjected to first-generation sequencing, and the sequencing result file hygm1.ab1 is obtained, and the peak data obtained by sequencing and the homologous sequence (internal reference template and target gene template SEQ ID NO.1 ~2) Submit them together to the computer program for comparison, and the result output is shown in the following table:

[0102] Table 1

[0103]

[0104] Hygm2 plant: The final PCR product obtained is subjected to first-generation sequenci...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for judging whether a PCR result is a false positive. First, estimate the number of target gene template molecules to be added in the PCR system; then add an internal reference template to the PCR system according to the number of target gene template molecules, and the internal reference template The number of molecules of the target gene template is controlled at 1 / n of the number of target gene template molecules; the internal reference template and the target gene template are highly homologous, so that the PCR primers can amplify the internal reference template and the target gene template with the same efficiency, and then the amplification results are sequenced Analysis; when the amplification result is dominated by the target gene fragment, it means that the sample is positive; when the amplification result is dominated by the internal reference template, it means that the sample is negative. The present invention adds an appropriate amount of internal reference templates according to the number of target gene template molecules. On the one hand, it can suppress the pollution signal, and its anti-pollution ability can reach the level of Southern blot. On the other hand, the present invention can identify transgene positives through simple PCR technology. , high reliability and low cost.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a method for judging whether a PCR result is a false positive. Background technique [0002] PCR reaction is a molecular biology technique used to amplify specific DNA fragments. The biggest feature of PCR is that it can greatly increase a small amount of DNA outside the body. PCR technology has high sensitivity and has been widely used. However, as a necessary solution for gene detection, it also has shortcomings, because it is too sensitive, and it is easy to be polluted by trace DNA in the environment, resulting in false positives. For example, in the experiment of transgenic detection Among them, because marker genes such as gus and hyg are often amplified, these fragments can still be amplified after a period of time without adding any templates. This is a headache encountered by many biological laboratories, so that the test results Unreliable, and ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6848
CPCC12Q1/6848C12Q2531/113C12Q2545/101
Inventor 李阳
Owner 海南伯远生物科技有限公司