Preparation method and applications of chicken Newcastle disease and egg drop syndrome bivalent genetic engineering subunit vaccine
A technology of egg drop syndrome and subunit vaccines, applied in the field of genetic engineering veterinary vaccines, can solve unseen problems and achieve the effects of promoting development, good social and economic benefits, and promoting social and economic progress
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Preparation of embodiment 1 fusion protein
[0021] 1. Construction of HN-knob protein particles
[0022] 1.1 Gene and primer synthesis
[0023] The expression sequence was recombined into the expression vector by the synthetic gene described below. The gene and primers were synthesized by Jinweizhi Company, and the synthetic gene sequence was recombined into the plasmid vector pUC19, and the plasmids containing the target gene were obtained as pUC-Hk; the following is the sequence of the synthetic gene fragment.
[0024] Synthetic gene fragment Hk:
[0025]CCTAGGGCCACCATGGCCTGGATGATGCTTCTCCTCGGACTCCTTGCTTATGGATCAGGAGTCGACTCTACCCCTCTCACCAGGATCATCTCCATGGGCAACAACCTCTTCGACAGCGGCTACGAAATTTTTGCCAGCTGCCCCCAGAACAAGGCCGCCAAGGTGGCTGGCTACGTGTACCTGACATCCGTGGGAGGCCTGGTCCACGGCACCATCCAAATCAAGGCCACCGCCGGCTACTGGTTTACCGGCGGCAACAGCGTGCAGGAGTCCATCAGGTTCGGCCTGGTGCTGTGTCCCTTCAGCGCCCGGGACCCTACAGCTAATCTGAGCGGCTGGCCCGCTCCTGTGGTGTGGAGCGGAGACTCCAACACCCCCCTGTACTTCGCCGCCAACGCCATCAGCTACACCAACAACC...
Embodiment 2
[0042] Example 2 Detection of immune efficacy
[0043] 1. Immune potency test of recombinant dual antigen protein
[0044] The dual antigen protein HN-knob obtained in Example 1 was mixed with an adjuvant (chitosan) at a ratio of 1:1 to make a subunit vaccine, and the immune efficacy test was carried out. Eighty 21-day-old SPF chickens were randomly divided into 4 groups: the blank control group and the dual antigen protein HN-knob vaccine group (0.5 mg / feather). Blood was collected from the hindwing vein at the 2nd, 4th, and 6th week after inoculation, and the serum was separated to measure the antibody titer by HI (hemocoagulase inhibition test method). The specific method is: take the test serum and serially dilute it with PBS, then take 0.025ml each and add it to 4 units of HA (Hemagglutinin, hemagglutinin) antigen in an equal volume. After 20 minutes, 0.05ml of 0.5% chicken erythrocyte suspension was added and mixed respectively. After incubation at room temperature for...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com