CNE10 gene knockout in epidermal stem cells by using CRISPR-Cas system
A technology of epidermal stem cells and cells, which is applied in the field of establishment of epidermal stem cell lines, can solve the problem of siRNA not stable inheritance, etc., and achieve high knockout efficiency, good knockout effect, and stable passage
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Embodiment 1, construction of CRISPR expression vector
[0023] gRNA design
[0024] According to the gene sequence of the target gene, through the applicant's unique optimization design method, the specific form of sgRNA obtained through specific screening is as follows:
[0025] CNE10-sgRNA1:5'to 3'gacgtcggattccagcctcc
[0026] CNE10-sgRNA2:5'to 3'ccagcgcctggggctctccg
[0027] According to the above gRNA, add CACC to its 5' end to obtain the forward oligonucleotide sequence, add AAAC to the 5' end of its complementary strand to obtain the reverse oligonucleotide sequence, and synthesize forward and reverse oligonucleotides respectively Nucleotide sequence, and then denature and anneal the synthesized sequence to obtain a double-stranded DNA fragment with BbsI sticky ends, as follows: Forward: 5'-CACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...
Embodiment 2
[0031] Example 2 Cloning of synergistic protein ESCS-higher and construction vector
[0032]Clone the synergistic protein ESCS-higher gene, and obtain the gene sequence described in SEQ ID NO: 1 through the method of whole gene synthesis. Using this sequence as a template, according to the sequences of the upstream and downstream primers are 5'-atgatatactttattagaat-3', 5 '-tcaagggatttccatttctc-3', primers and whole genome were synthesized by Shanghai Sangon Co., Ltd. The target gene fragment of ESCS-higher gene was amplified by PCR reaction. The amplification reaction system was as follows: 95°C, 40s, 57°C, 1min, 72°C, 1min, 72°C, 10min, cycled 35 times, and the PCR product was produced by Shanghai Shenggong Co., Ltd. Sequencing was performed, and the binding was a complete match to SEQ ID NO:1 by sequencing. Subsequently, the target gene amplified by PCR was connected to the empty vector lentiviral vector pHIV-CS-CDF-CG-PRE, and the recombinant lentiviral vector was identifi...
Embodiment 3
[0033] Example 3 Application Analysis of CRISPR / Cas9 in Epidermal Stem Cells
[0034] The sgRNA expression plasmid prepared in Example 1 and the known Cas9 expression plasmid were co-transfected into epidermal stem cells. Using liposome transfection method, the transfection epidermal stem cell transfection system and reagents constructed were Lipofectamine TM 2000 (Invitrogen Company), the detailed steps of transfection refer to the transfection instructions. Stem cells not transfected with the synergistic gene of Example 2 were used as a positive control.
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com

